EMAIL THIS PAGE TO A FRIEND

HMGCS1

3-hydroxy-3-methylglutaryl-CoA synthase 1 (soluble)

187 Gene Product Result for
Synonyms: HMGCS
UniProtKB ID: Q01581, B2RDL8
Gene ID:
Mouse(208715) 3-hydroxy-3-methylglutaryl-Coenzyme A synthase 1
Rat(29637) 3-hydroxy-3-methylglutaryl-CoA synthase 1 (soluble)
Zebrafish(394060) 3-hydroxy-3-methylglutaryl-Coenzyme A synthase 1 (soluble)
domestic cat(101091999) 3-hydroxy-3-methylglutaryl-CoA synthase 1 (soluble)
cow(407767) HMGCS1 protein-like
Horse(100065037) 3-hydroxy-3-methylglutaryl-CoA synthase 1 (soluble)
dog(479344) 3-hydroxy-3-methylglutaryl-CoA synthase 1 (soluble)
chicken(396379) 3-hydroxy-3-methylglutaryl-CoA synthase 1 (soluble)
sheep(101122979) 3-hydroxy-3-methylglutaryl-CoA synthase 1 (soluble)
domestic guinea pig(100731467) 3-hydroxy-3-methylglutaryl-CoA synthase 1 (soluble)
naked mole-rat(101712604) 3-hydroxy-3-methylglutaryl-CoA synthase 1 (soluble)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145942 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145942 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145942 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002130 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002130 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002130 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001098272 Rosetta Predictions human pricing
NM_002130 Rosetta Predictions human pricing
NM_017268 Rosetta Predictions rat pricing
XM_579405 Rosetta Predictions rat pricing
NM_145942 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098272 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00318768 predicted 434
2 SASI_Hs02_00318769 predicted 1230
3 SASI_Hs02_00318770 predicted 1357
4 SASI_Hs02_00318771 predicted 536
5 SASI_Hs02_00318772 predicted 486
6 SASI_Hs02_00318773 predicted 1568
7 SASI_Hs02_00318774 predicted 822
8 SASI_Hs02_00318775 predicted 575
9 SASI_Hs02_00318776 predicted 832
10 SASI_Hs02_00318777 predicted 989
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002130 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00072033 predicted 379
2 SASI_Hs01_00072034 predicted 1165
3 SASI_Hs02_00333276 predicted 1295
4 SASI_Hs01_00072036 predicted 470
5 SASI_Hs02_00333277 predicted 429
6 SASI_Hs01_00072037 predicted 1509
7 SASI_Hs01_00072038 predicted 766
8 SASI_Hs01_00072039 predicted 516
9 SASI_Hs01_00072040 predicted 779
10 SASI_Hs01_00072042 predicted 927
11 SASI_Hs01_00072035 predicted 255
12 SASI_Hs01_00072041 predicted 425
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017268 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00038469 predicted 1571
2 SASI_Rn01_00038470 predicted 570
3 SASI_Rn01_00038471 predicted 421
4 SASI_Rn02_00261674 predicted 906
5 SASI_Rn01_00038473 predicted 1292
6 SASI_Rn01_00038474 predicted 637
7 SASI_Rn01_00038475 predicted 915
8 SASI_Rn01_00038476 predicted 375
9 SASI_Rn02_00261675 predicted 316
10 SASI_Rn01_00038478 predicted 821
11 SASI_Rn01_00038472 predicted 879
12 SASI_Rn01_00038477 predicted 1443
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579405 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00126236 predicted 577
2 SASI_Rn01_00126237 predicted 424
3 SASI_Rn01_00126238 predicted 917
4 SASI_Rn01_00126239 predicted 872
5 SASI_Rn01_00126240 predicted 1303
6 SASI_Rn01_00126241 predicted 633
7 SASI_Rn01_00126242 predicted 919
8 SASI_Rn01_00126243 predicted 377
9 SASI_Rn01_00126244 predicted 825
10 SASI_Rn01_00126245 predicted 1130
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145942 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00179016 predicted 1355
2 SASI_Mm02_00341394 predicted 593
3 SASI_Mm01_00179018 predicted 213
4 SASI_Mm02_00341395 predicted 1601
5 SASI_Mm01_00179019 predicted 898
6 SASI_Mm01_00179020 predicted 1121
7 SASI_Mm02_00341396 predicted 847
8 SASI_Mm01_00179021 predicted 1135
9 SASI_Mm01_00179022 predicted 400
10 SASI_Mm01_00179023 predicted 951
11 SASI_Mm01_00179015 predicted 451
12 SASI_Mm01_00179017 predicted 1480
13 SASI_Mm01_00179024 predicted 1467
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145942
HMGCS1 MISSION shRNA Bacterial Glycerol Stock
3-hydroxy-3-methylglutaryl-CoA synthase 1 (soluble)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000440960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145942.4-557s21c1
Sequence:CCGGAGCTCTTGGGATGGACGATATCTCGAGATATCGTCCATCCCAAGAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145942.4-424s21c1
Sequence:CCGGGAAATCAGTGAAGTCTAATTTCTCGAGAAATTAGACTTCACTGATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145942.4-904s21c1
Sequence:CCGGGATCTTTCACTCACCATATTGCTCGAGCAATATGGTGAGTGAAAGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145942.4-402s21c1
Sequence:CCGGCAGAGACAATCATCGACAAATCTCGAGATTTGTCGATGATTGTCTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145942.2-1530s1c1
Sequence:CCGGCCTTCACAAATGACCACAGTTCTCGAGAACTGTGGTCATTTGTGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145942.2-200s1c1
Sequence:CCGGCCTTCTCAATATGTCGATCAACTCGAGTTGATCGACATATTGAGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076043    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145942.2-1766s1c1
Sequence:CCGGGCAGATTATGTGTTGCTTAAACTCGAGTTTAAGCAACACATAATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145942.2-1118s1c1
Sequence:CCGGGCGTCTTTGCTTGTGTCTAATCTCGAGATTAGACACAAGCAAAGACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145942.2-1328s1c1
Sequence:CCGGGCAAGTTTATGTGACCTTAAACTCGAGTTTAAGGTCACATAAACTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145942
HMGCS1 MISSION shRNA shRNA Plasmid DNA
3-hydroxy-3-methylglutaryl-CoA synthase 1 (soluble)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000440960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145942.4-557s21c1
Sequence:CCGGAGCTCTTGGGATGGACGATATCTCGAGATATCGTCCATCCCAAGAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145942.4-424s21c1
Sequence:CCGGGAAATCAGTGAAGTCTAATTTCTCGAGAAATTAGACTTCACTGATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145942.4-904s21c1
Sequence:CCGGGATCTTTCACTCACCATATTGCTCGAGCAATATGGTGAGTGAAAGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145942.4-402s21c1
Sequence:CCGGCAGAGACAATCATCGACAAATCTCGAGATTTGTCGATGATTGTCTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145942.2-1530s1c1
Sequence:CCGGCCTTCACAAATGACCACAGTTCTCGAGAACTGTGGTCATTTGTGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145942.2-200s1c1
Sequence:CCGGCCTTCTCAATATGTCGATCAACTCGAGTTGATCGACATATTGAGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076043    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145942.2-1766s1c1
Sequence:CCGGGCAGATTATGTGTTGCTTAAACTCGAGTTTAAGCAACACATAATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145942.2-1118s1c1
Sequence:CCGGGCGTCTTTGCTTGTGTCTAATCTCGAGATTAGACACAAGCAAAGACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145942.2-1328s1c1
Sequence:CCGGGCAAGTTTATGTGACCTTAAACTCGAGTTTAAGGTCACATAAACTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145942
HMGCS1 MISSION shRNA Lentiviral Transduction Particles
3-hydroxy-3-methylglutaryl-CoA synthase 1 (soluble)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000440960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145942.4-557s21c1
Sequence:CCGGAGCTCTTGGGATGGACGATATCTCGAGATATCGTCCATCCCAAGAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145942.4-424s21c1
Sequence:CCGGGAAATCAGTGAAGTCTAATTTCTCGAGAAATTAGACTTCACTGATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145942.4-904s21c1
Sequence:CCGGGATCTTTCACTCACCATATTGCTCGAGCAATATGGTGAGTGAAAGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145942.4-402s21c1
Sequence:CCGGCAGAGACAATCATCGACAAATCTCGAGATTTGTCGATGATTGTCTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145942.2-1530s1c1
Sequence:CCGGCCTTCACAAATGACCACAGTTCTCGAGAACTGTGGTCATTTGTGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145942.2-200s1c1
Sequence:CCGGCCTTCTCAATATGTCGATCAACTCGAGTTGATCGACATATTGAGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076043    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145942.2-1766s1c1
Sequence:CCGGGCAGATTATGTGTTGCTTAAACTCGAGTTTAAGCAACACATAATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145942.2-1118s1c1
Sequence:CCGGGCGTCTTTGCTTGTGTCTAATCTCGAGATTAGACACAAGCAAAGACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145942.2-1328s1c1
Sequence:CCGGGCAAGTTTATGTGACCTTAAACTCGAGTTTAAGGTCACATAAACTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002130
VALIDATED
HMGCS1 MISSION shRNA Bacterial Glycerol Stock
3-hydroxy-3-methylglutaryl-CoA synthase 1 (soluble)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_002130.6-931s21c1
Sequence:GTACCGGGATCTTTCACTCACCATATTGCTCGAGCAATATGGTGAGTGAAAGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230558    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_002130.6-2052s21c1
Sequence:CCGGAGGTACTAATCTCCAATTAAACTCGAGTTTAATTGGAGATTAGTACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_002130.6-1608s21c1
Sequence:CCGGACATAGCAACTGAGCATATTCCTCGAGGAATATGCTCAGTTGCTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002130.6-1448s21c1
Sequence:CCGGCATCATTTGGTCAACTATATTCTCGAGAATATAGTTGACCAAATGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_002130.6-205s21c1
Sequence:CCGGTGTTGCCCTTGAGATCTATTTCTCGAGAAATAGATCTCAAGGGCAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_002130.3-613s1c1
Sequence:CCGGCCACAGGAAATGCTAGACCTACTCGAGTAGGTCTAGCATTTCCTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002130.3-1377s1c1
Sequence:CCGGGCACAAGATGTCTTCGCTGAACTCGAGTTCAGCGAAGACATCTTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_002130.3-741s1c1
Sequence:CCGGCCTGATATGCTATCTGAATATCTCGAGATATTCAGATAGCATATCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_002130.3-416s1c1
Sequence:CCGGCGACAAATCAAAGTCTGTGAACTCGAGTTCACAGACTTTGATTTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_002130.3-1420s1c1
Sequence:CCGGCCCATCATTTGGTCAACTATACTCGAGTATAGTTGACCAAATGATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002130
VALIDATED
HMGCS1 MISSION shRNA shRNA Plasmid DNA
3-hydroxy-3-methylglutaryl-CoA synthase 1 (soluble)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_002130.6-931s21c1
Sequence:GTACCGGGATCTTTCACTCACCATATTGCTCGAGCAATATGGTGAGTGAAAGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230558    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_002130.6-2052s21c1
Sequence:CCGGAGGTACTAATCTCCAATTAAACTCGAGTTTAATTGGAGATTAGTACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_002130.6-1608s21c1
Sequence:CCGGACATAGCAACTGAGCATATTCCTCGAGGAATATGCTCAGTTGCTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002130.6-1448s21c1
Sequence:CCGGCATCATTTGGTCAACTATATTCTCGAGAATATAGTTGACCAAATGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_002130.6-205s21c1
Sequence:CCGGTGTTGCCCTTGAGATCTATTTCTCGAGAAATAGATCTCAAGGGCAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_002130.3-613s1c1
Sequence:CCGGCCACAGGAAATGCTAGACCTACTCGAGTAGGTCTAGCATTTCCTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002130.3-1377s1c1
Sequence:CCGGGCACAAGATGTCTTCGCTGAACTCGAGTTCAGCGAAGACATCTTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_002130.3-741s1c1
Sequence:CCGGCCTGATATGCTATCTGAATATCTCGAGATATTCAGATAGCATATCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_002130.3-416s1c1
Sequence:CCGGCGACAAATCAAAGTCTGTGAACTCGAGTTCACAGACTTTGATTTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_002130.3-1420s1c1
Sequence:CCGGCCCATCATTTGGTCAACTATACTCGAGTATAGTTGACCAAATGATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002130
VALIDATED
HMGCS1 MISSION shRNA Lentiviral Transduction Particles
3-hydroxy-3-methylglutaryl-CoA synthase 1 (soluble)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_002130.6-931s21c1
Sequence:GTACCGGGATCTTTCACTCACCATATTGCTCGAGCAATATGGTGAGTGAAAGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230558    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_002130.6-2052s21c1
Sequence:CCGGAGGTACTAATCTCCAATTAAACTCGAGTTTAATTGGAGATTAGTACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_002130.6-1608s21c1
Sequence:CCGGACATAGCAACTGAGCATATTCCTCGAGGAATATGCTCAGTTGCTATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002130.6-1448s21c1
Sequence:CCGGCATCATTTGGTCAACTATATTCTCGAGAATATAGTTGACCAAATGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_002130.6-205s21c1
Sequence:CCGGTGTTGCCCTTGAGATCTATTTCTCGAGAAATAGATCTCAAGGGCAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_002130.3-613s1c1
Sequence:CCGGCCACAGGAAATGCTAGACCTACTCGAGTAGGTCTAGCATTTCCTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002130.3-1377s1c1
Sequence:CCGGGCACAAGATGTCTTCGCTGAACTCGAGTTCAGCGAAGACATCTTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_002130.3-741s1c1
Sequence:CCGGCCTGATATGCTATCTGAATATCTCGAGATATTCAGATAGCATATCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_002130.3-416s1c1
Sequence:CCGGCGACAAATCAAAGTCTGTGAACTCGAGTTCACAGACTTTGATTTGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_002130.3-1420s1c1
Sequence:CCGGCCCATCATTTGGTCAACTATACTCGAGTATAGTTGACCAAATGATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)