EMAIL THIS PAGE TO A FRIEND

HMGCS2

3-hydroxy-3-methylglutaryl-CoA synthase 2 (mitochondrial)

59 Gene Product Result for
UniProtKB ID: P54868, B7Z8R3, D3Y5K6, Q5SZU2, Q6IBF4
Gene ID:
Human(3158) Summary: The protein encoded by this gene belongs to the HMG-CoA synthase family. It is a mitochondrial enzyme that catalyzes the first reaction of ketogenesis, a metabolic pathway that provides lipid-derived energy for various organs during times of carbohydrate deprivation, such as fasting. Mutations in this gene are associated with HMG-CoA synthase deficiency. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Oct 2009]
Mouse(15360) 3-hydroxy-3-methylglutaryl-Coenzyme A synthase 2
Rat(24450) 3-hydroxy-3-methylglutaryl-CoA synthase 2 (mitochondrial)
Goat(100860890) 3-hydroxy-3-methylglutaryl-CoA synthase 2 (mitochondrial)
Domestic Rabbit(100343479) 3-hydroxy-3-methylglutaryl-CoA synthase 2 (mitochondrial)
sheep(101111590) 3-hydroxy-3-methylglutaryl-CoA synthase 2 (mitochondrial)
domestic guinea pig(100727078) 3-hydroxy-3-methylglutaryl-CoA synthase 2 (mitochondrial)
naked mole-rat(101712063) 3-hydroxy-3-methylglutaryl-CoA synthase 2 (mitochondrial)
chicken(424380) 3-hydroxy-3-methylglutaryl-CoA synthase 2 (mitochondrial)
dog(607923) 3-hydroxy-3-methylglutaryl-CoA synthase 2 (mitochondrial)
domestic cat(101088768) 3-hydroxy-3-methylglutaryl-CoA synthase 2 (mitochondrial)
cow(503684) 3-hydroxy-3-methylglutaryl-CoA synthase 2 (mitochondrial)
Horse(100059971) 3-hydroxy-3-methylglutaryl-CoA synthase 2 (mitochondrial)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005518 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005518 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005518 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008256 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008256 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008256 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005518 Rosetta Predictions human pricing
NM_173094 Rosetta Predictions rat pricing
NM_008256 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005518 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00223463 predicted 507
2 SASI_Hs01_00223464 predicted 740
3 SASI_Hs01_00223465 predicted 1448
4 SASI_Hs01_00223466 predicted 629
5 SASI_Hs01_00223467 predicted 1289
6 SASI_Hs01_00223468 predicted 496
7 SASI_Hs01_00223469 predicted 601
8 SASI_Hs01_00223470 predicted 1273
9 SASI_Hs02_00339733 predicted 762
10 SASI_Hs02_00339734 predicted 228
11 SASI_Hs01_00223471 predicted 1093
12 SASI_Hs01_00223472 predicted 1576
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173094 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00077143 predicted 1436
2 SASI_Rn01_00077144 predicted 1083
3 SASI_Rn01_00077145 predicted 1563
4 SASI_Rn01_00077146 predicted 1172
5 SASI_Rn01_00077147 predicted 506
6 SASI_Rn01_00077148 predicted 632
7 SASI_Rn01_00077149 predicted 1417
8 SASI_Rn01_00077150 predicted 1159
9 SASI_Rn01_00077151 predicted 395
10 SASI_Rn01_00077152 predicted 1511
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008256 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00024582 predicted 1625
2 SASI_Mm01_00024583 predicted 1154
3 SASI_Mm01_00024584 predicted 864
4 SASI_Mm01_00024585 predicted 509
5 SASI_Mm02_00313462 predicted 1090
6 SASI_Mm02_00313463 predicted 1652
7 SASI_Mm01_00024586 predicted 625
8 SASI_Mm01_00024588 predicted 639
9 SASI_Mm01_00024589 predicted 1375
10 SASI_Mm01_00024590 predicted 746
11 SASI_Mm01_00024587 predicted 933
12 SASI_Mm01_00024591 predicted 1253
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005518
HMGCS2 MISSION shRNA Bacterial Glycerol Stock
3-hydroxy-3-methylglutaryl-CoA synthase 2 (mitochondrial)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000045858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005518.1-1420s1c1
Sequence:CCGGCCTGAGGAGTTCACAGAAATACTCGAGTATTTCTGTGAACTCCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005518.1-923s1c1
Sequence:CCGGCCCTTGACGATTTACAGTATACTCGAGTATACTGTAAATCGTCAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005518.1-523s1c1
Sequence:CCGGGAGGGCATAGATACCACCAATCTCGAGATTGGTGGTATCTATGCCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005518.1-271s1c1
Sequence:CCGGGAGAAGTATAACAATGTGGAACTCGAGTTCCACATTGTTATACTTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005518.1-1277s1c1
Sequence:CCGGCCTTCTCTTATGGCTCTGGTTCTCGAGAACCAGAGCCATAAGAGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000440562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005518.3-680s21c1
Sequence:CCGGGCCGTCTATCCCAGTGGTAATCTCGAGATTACCACTGGGATAGACGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005518.3-953s21c1
Sequence:CCGACCCTTCACCCTTGACGATTTACTCGAGTAAATCGTCAAGGGTGAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005518.3-538s21c1
Sequence:CCGGGGATTCAGGCAATACTGATATCTCGAGATATCAGTATTGCCTGAATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005518
HMGCS2 MISSION shRNA shRNA Plasmid DNA
3-hydroxy-3-methylglutaryl-CoA synthase 2 (mitochondrial)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000045858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005518.1-1420s1c1
Sequence:CCGGCCTGAGGAGTTCACAGAAATACTCGAGTATTTCTGTGAACTCCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005518.1-923s1c1
Sequence:CCGGCCCTTGACGATTTACAGTATACTCGAGTATACTGTAAATCGTCAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005518.1-523s1c1
Sequence:CCGGGAGGGCATAGATACCACCAATCTCGAGATTGGTGGTATCTATGCCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005518.1-271s1c1
Sequence:CCGGGAGAAGTATAACAATGTGGAACTCGAGTTCCACATTGTTATACTTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005518.1-1277s1c1
Sequence:CCGGCCTTCTCTTATGGCTCTGGTTCTCGAGAACCAGAGCCATAAGAGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000440562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005518.3-680s21c1
Sequence:CCGGGCCGTCTATCCCAGTGGTAATCTCGAGATTACCACTGGGATAGACGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005518.3-953s21c1
Sequence:CCGACCCTTCACCCTTGACGATTTACTCGAGTAAATCGTCAAGGGTGAAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005518.3-538s21c1
Sequence:CCGGGGATTCAGGCAATACTGATATCTCGAGATATCAGTATTGCCTGAATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005518
HMGCS2 MISSION shRNA Lentiviral Transduction Particles
3-hydroxy-3-methylglutaryl-CoA synthase 2 (mitochondrial)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000045858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005518.1-1420s1c1
Sequence:CCGGCCTGAGGAGTTCACAGAAATACTCGAGTATTTCTGTGAACTCCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005518.1-923s1c1
Sequence:CCGGCCCTTGACGATTTACAGTATACTCGAGTATACTGTAAATCGTCAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005518.1-523s1c1
Sequence:CCGGGAGGGCATAGATACCACCAATCTCGAGATTGGTGGTATCTATGCCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005518.1-271s1c1
Sequence:CCGGGAGAAGTATAACAATGTGGAACTCGAGTTCCACATTGTTATACTTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005518.1-1277s1c1
Sequence:CCGGCCTTCTCTTATGGCTCTGGTTCTCGAGAACCAGAGCCATAAGAGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000440562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005518.3-680s21c1
Sequence:CCGGGCCGTCTATCCCAGTGGTAATCTCGAGATTACCACTGGGATAGACGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005518.3-953s21c1
Sequence:CCGACCCTTCACCCTTGACGATTTACTCGAGTAAATCGTCAAGGGTGAAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005518.3-538s21c1
Sequence:CCGGGGATTCAGGCAATACTGATATCTCGAGATATCAGTATTGCCTGAATCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008256
HMGCS2 MISSION shRNA Bacterial Glycerol Stock
3-hydroxy-3-methylglutaryl-CoA synthase 2 (mitochondrial)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000075828    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008256.2-2803s1c1
Sequence:CCGGCCCTCGATCTTTCCAGAACTTCTCGAGAAGTTCTGGAAAGATCGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008256.2-1170s1c1
Sequence:CCGGCCTCTCCACAAATAATGGGAACTCGAGTTCCCATTATTTGTGGAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008256.2-768s1c1
Sequence:CCGGCGACTTCTACAAACCAAACTTCTCGAGAAGTTTGGTTTGTAGAAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008256.2-924s1c1
Sequence:CCGGCCTCGATGATGTGCAGTATATCTCGAGATATACTGCACATCATCGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008256.2-923s1c1
Sequence:CCGGCCCTCGATGATGTGCAGTATACTCGAGTATACTGCACATCATCGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008256
HMGCS2 MISSION shRNA shRNA Plasmid DNA
3-hydroxy-3-methylglutaryl-CoA synthase 2 (mitochondrial)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000075828    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008256.2-2803s1c1
Sequence:CCGGCCCTCGATCTTTCCAGAACTTCTCGAGAAGTTCTGGAAAGATCGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008256.2-1170s1c1
Sequence:CCGGCCTCTCCACAAATAATGGGAACTCGAGTTCCCATTATTTGTGGAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008256.2-768s1c1
Sequence:CCGGCGACTTCTACAAACCAAACTTCTCGAGAAGTTTGGTTTGTAGAAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008256.2-924s1c1
Sequence:CCGGCCTCGATGATGTGCAGTATATCTCGAGATATACTGCACATCATCGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008256.2-923s1c1
Sequence:CCGGCCCTCGATGATGTGCAGTATACTCGAGTATACTGCACATCATCGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008256
HMGCS2 MISSION shRNA Lentiviral Transduction Particles
3-hydroxy-3-methylglutaryl-CoA synthase 2 (mitochondrial)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000075828    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008256.2-2803s1c1
Sequence:CCGGCCCTCGATCTTTCCAGAACTTCTCGAGAAGTTCTGGAAAGATCGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008256.2-1170s1c1
Sequence:CCGGCCTCTCCACAAATAATGGGAACTCGAGTTCCCATTATTTGTGGAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008256.2-768s1c1
Sequence:CCGGCGACTTCTACAAACCAAACTTCTCGAGAAGTTTGGTTTGTAGAAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008256.2-924s1c1
Sequence:CCGGCCTCGATGATGTGCAGTATATCTCGAGATATACTGCACATCATCGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008256.2-923s1c1
Sequence:CCGGCCCTCGATGATGTGCAGTATACTCGAGTATACTGCACATCATCGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)