EMAIL THIS PAGE TO A FRIEND

HMGN2

high mobility group nucleosomal binding domain 2

81 Gene Product Result for
Synonyms: HMG17
UniProtKB ID: P05204, Q0VGD5, Q6FGI5, Q96C64
Gene ID:
Mouse(15331) high mobility group nucleosomal binding domain 2
Rat(114637) high mobility group nucleosome binding domain 2
Zebrafish(569904) high-mobility group nucleosomal binding domain 2
chicken(768675) high mobility group nucleosomal binding domain 2
cow(512161) high mobility group nucleosomal binding domain 2
dog(403686) non-histone chromosomal protein HMG-17
sheep(101115771) high mobility group nucleosomal binding domain 2
domestic guinea pig(100728891) high mobility group nucleosomal binding domain 2
naked mole-rat(101712613) high mobility group nucleosomal binding domain 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005517 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005517 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005517 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016957 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016957 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016957 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005517 Rosetta Predictions human pricing
NM_001025624 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005517 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00185419 predicted 644
2 SASI_Hs01_00185418 predicted 882
3 SASI_Hs01_00185420 predicted 656
4 SASI_Hs01_00185421 predicted 660
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025624 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00078859 predicted 892
2 SASI_Rn02_00203177 predicted 218
3 SASI_Rn01_00078860 predicted 226
4 SASI_Rn01_00078861 predicted 199
5 SASI_Rn01_00078862 predicted 221
6 SASI_Rn01_00078863 predicted 212
7 SASI_Rn01_00078864 predicted 712
8 SASI_Rn01_00078866 predicted 577
9 SASI_Rn02_00203178 predicted 422
10 SASI_Rn01_00078867 predicted 303
11 SASI_Rn01_00078865 predicted 426
12 SASI_Rn01_00078868 predicted 530
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005517
VALIDATED
HMGN2 MISSION shRNA Bacterial Glycerol Stock
high mobility group nucleosomal binding domain 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000018548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_005517.1-239s1c1
Sequence:CCGGCCCTGCAAAGAAGGGAGAGAACTCGAGTTCTCTCCCTTCTTTGCAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005517.1-139s1c1
Sequence:CCGGAGGGAGATAAAGCAAAGGTGACTCGAGTCACCTTTGCTTTATCTCCCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_005517.1-339s1c1
Sequence:CCGGGACCAGGCACAGAAAGCTGAACTCGAGTTCAGCTTTCTGTGCCTGGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_005517.1-255s1c1
Sequence:CCGGGAGAAGGTACCCAAAGGGAAACTCGAGTTTCCCTTTGGGTACCTTCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_005517.1-160s1c1
Sequence:CCGGAGGACGAACCACAGAGAAGATCTCGAGATCTTCTCTGTGGTTCGTCCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005517
VALIDATED
HMGN2 MISSION shRNA shRNA Plasmid DNA
high mobility group nucleosomal binding domain 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000018548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_005517.1-239s1c1
Sequence:CCGGCCCTGCAAAGAAGGGAGAGAACTCGAGTTCTCTCCCTTCTTTGCAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005517.1-139s1c1
Sequence:CCGGAGGGAGATAAAGCAAAGGTGACTCGAGTCACCTTTGCTTTATCTCCCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_005517.1-339s1c1
Sequence:CCGGGACCAGGCACAGAAAGCTGAACTCGAGTTCAGCTTTCTGTGCCTGGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_005517.1-255s1c1
Sequence:CCGGGAGAAGGTACCCAAAGGGAAACTCGAGTTTCCCTTTGGGTACCTTCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_005517.1-160s1c1
Sequence:CCGGAGGACGAACCACAGAGAAGATCTCGAGATCTTCTCTGTGGTTCGTCCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005517
VALIDATED
HMGN2 MISSION shRNA Lentiviral Transduction Particles
high mobility group nucleosomal binding domain 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000018548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_005517.1-239s1c1
Sequence:CCGGCCCTGCAAAGAAGGGAGAGAACTCGAGTTCTCTCCCTTCTTTGCAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005517.1-139s1c1
Sequence:CCGGAGGGAGATAAAGCAAAGGTGACTCGAGTCACCTTTGCTTTATCTCCCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_005517.1-339s1c1
Sequence:CCGGGACCAGGCACAGAAAGCTGAACTCGAGTTCAGCTTTCTGTGCCTGGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_005517.1-255s1c1
Sequence:CCGGGAGAAGGTACCCAAAGGGAAACTCGAGTTTCCCTTTGGGTACCTTCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_005517.1-160s1c1
Sequence:CCGGAGGACGAACCACAGAGAAGATCTCGAGATCTTCTCTGTGGTTCGTCCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016957
HMGN2 MISSION shRNA Bacterial Glycerol Stock
high mobility group nucleosomal binding domain 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108985    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016957.2-994s1c1
Sequence:CCGGGCATTGAATGAAGACTTCATTCTCGAGAATGAAGTCTTCATTCAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016957.2-230s1c1
Sequence:CCGGCCCTGCGAAGAAGGGAGAGAACTCGAGTTCTCTCCCTTCTTCGCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016957.2-291s1c1
Sequence:CCGGGATGCGAATAATCCTGCAGAACTCGAGTTCTGCAGGATTATTCGCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016957.2-171s1c1
Sequence:CCGGTCTGCGAGGTTGTCTGCTAAACTCGAGTTTAGCAGACAACCTCGCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016957.2-282s1c1
Sequence:CCGGGCCGGGAAGGATGCGAATAATCTCGAGATTATTCGCATCCTTCCCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016957
HMGN2 MISSION shRNA shRNA Plasmid DNA
high mobility group nucleosomal binding domain 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108985    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016957.2-994s1c1
Sequence:CCGGGCATTGAATGAAGACTTCATTCTCGAGAATGAAGTCTTCATTCAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016957.2-230s1c1
Sequence:CCGGCCCTGCGAAGAAGGGAGAGAACTCGAGTTCTCTCCCTTCTTCGCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016957.2-291s1c1
Sequence:CCGGGATGCGAATAATCCTGCAGAACTCGAGTTCTGCAGGATTATTCGCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016957.2-171s1c1
Sequence:CCGGTCTGCGAGGTTGTCTGCTAAACTCGAGTTTAGCAGACAACCTCGCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016957.2-282s1c1
Sequence:CCGGGCCGGGAAGGATGCGAATAATCTCGAGATTATTCGCATCCTTCCCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016957
HMGN2 MISSION shRNA Lentiviral Transduction Particles
high mobility group nucleosomal binding domain 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108985    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016957.2-994s1c1
Sequence:CCGGGCATTGAATGAAGACTTCATTCTCGAGAATGAAGTCTTCATTCAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016957.2-230s1c1
Sequence:CCGGCCCTGCGAAGAAGGGAGAGAACTCGAGTTCTCTCCCTTCTTCGCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016957.2-291s1c1
Sequence:CCGGGATGCGAATAATCCTGCAGAACTCGAGTTCTGCAGGATTATTCGCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016957.2-171s1c1
Sequence:CCGGTCTGCGAGGTTGTCTGCTAAACTCGAGTTTAGCAGACAACCTCGCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016957.2-282s1c1
Sequence:CCGGGCCGGGAAGGATGCGAATAATCTCGAGATTATTCGCATCCTTCCCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)