EMAIL THIS PAGE TO A FRIEND

HMGN2P46

high mobility group nucleosomal binding domain 2 pseudogene 46

104 Gene Product Result for
Synonyms: C15orf21 D-PCa-2
Species: Human HMGN2P46(283651)
UniProtKB ID: Q86SG4, Q495B5, Q86SH8, Q8N8I5
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173609 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173609 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173609 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005266 Rosetta Predictions human pricing
NM_001005267 Rosetta Predictions human pricing
NM_001005268 Rosetta Predictions human pricing
NM_001005269 Rosetta Predictions human pricing
NM_173609 Rosetta Predictions human pricing
NR_022014 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005266 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00118956 predicted 1487
2 SASI_Hs01_00118957 predicted 1610
3 SASI_Hs01_00118958 predicted 1503
4 SASI_Hs01_00118959 predicted 999
5 SASI_Hs01_00118960 predicted 917
6 SASI_Hs01_00118961 predicted 1607
7 SASI_Hs01_00118962 predicted 1484
8 SASI_Hs01_00118963 predicted 1506
9 SASI_Hs01_00118964 predicted 938
10 SASI_Hs01_00118965 predicted 927
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005267 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00091575 predicted 1246
2 SASI_Hs01_00091576 predicted 1359
3 SASI_Hs01_00091577 predicted 1249
4 SASI_Hs01_00091578 predicted 1360
5 SASI_Hs01_00091579 predicted 1238
6 SASI_Hs01_00091580 predicted 1259
7 SASI_Hs01_00091581 predicted 684
8 SASI_Hs01_00091582 predicted 685
9 SASI_Hs01_00091583 predicted 1231
10 SASI_Hs01_00091584 predicted 677
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005268 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00030579 predicted 1263
2 SASI_Hs01_00030580 predicted 1378
3 SASI_Hs01_00030581 predicted 1274
4 SASI_Hs01_00030582 predicted 772
5 SASI_Hs01_00030583 predicted 688
6 SASI_Hs01_00030584 predicted 1389
7 SASI_Hs01_00030585 predicted 1260
8 SASI_Hs01_00030586 predicted 1283
9 SASI_Hs01_00030587 predicted 704
10 SASI_Hs01_00030588 predicted 703
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005269 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00239652 predicted 1266
2 SASI_Hs01_00239653 predicted 1376
3 SASI_Hs01_00239654 predicted 1266
4 SASI_Hs01_00239655 predicted 777
5 SASI_Hs01_00239656 predicted 686
6 SASI_Hs01_00239657 predicted 1379
7 SASI_Hs01_00239658 predicted 1255
8 SASI_Hs01_00239659 predicted 1273
9 SASI_Hs01_00239660 predicted 704
10 SASI_Hs01_00239661 predicted 698
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173609 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00160042 predicted 1486
2 SASI_Hs01_00160043 predicted 1606
3 SASI_Hs01_00160044 predicted 1497
4 SASI_Hs01_00160045 predicted 995
5 SASI_Hs01_00160046 predicted 907
6 SASI_Hs01_00160047 predicted 1609
7 SASI_Hs01_00160048 predicted 1481
8 SASI_Hs01_00160049 predicted 1498
9 SASI_Hs01_00160050 predicted 928
10 SASI_Hs01_00160051 predicted 924
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_022014 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00381582 predicted 1683
2 SASI_Hs02_00381583 predicted 1490
3 SASI_Hs02_00381584 predicted 1598
4 SASI_Hs02_00381585 predicted 1001
5 SASI_Hs02_00381586 predicted 911
6 SASI_Hs02_00381587 predicted 1600
7 SASI_Hs02_00381588 predicted 1472
8 SASI_Hs02_00381589 predicted 1497
9 SASI_Hs02_00381590 predicted 930
10 SASI_Hs02_00381591 predicted 918
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173609
HMGN2P46 MISSION shRNA Bacterial Glycerol Stock
high mobility group nucleosomal binding domain 2 pseudogene 46
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130847    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173609.1-925s1c1
Sequence:CCGGGATCCACAAGGTTGTCTGCTACTCGAGTAGCAGACAACCTTGTGGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130752    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173609.1-1114s1c1
Sequence:CCGGGAGATGCCAAGTGAAGTGTGTCTCGAGACACACTTCACTTGGCATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173609.1-1120s1c1
Sequence:CCGGCCAAGTGAAGTGTGTGCATTTCTCGAGAAATGCACACACTTCACTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173609.1-1119s1c1
Sequence:CCGGGCCAAGTGAAGTGTGTGCATTCTCGAGAATGCACACACTTCACTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173609.1-912s1c1
Sequence:CCGGGAACTGCAGAGAAGATCCACACTCGAGTGTGGATCTTCTCTGCAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173609.1-765s1c1
Sequence:CCGGGTGTGAAGAAGAAGAGGCGATCTCGAGATCGCCTCTTCTTCTTCACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128036    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173609.1-1097s1c1
Sequence:CCGGGAAAGCTAAAGGTGCTGGAGACTCGAGTCTCCAGCACCTTTAGCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173609.1-714s1c1
Sequence:CCGGGCATTTACTTCTCTGGCTACACTCGAGTGTAGCCAGAGAAGTAAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173609
HMGN2P46 MISSION shRNA shRNA Plasmid DNA
high mobility group nucleosomal binding domain 2 pseudogene 46
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130847    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173609.1-925s1c1
Sequence:CCGGGATCCACAAGGTTGTCTGCTACTCGAGTAGCAGACAACCTTGTGGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130752    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173609.1-1114s1c1
Sequence:CCGGGAGATGCCAAGTGAAGTGTGTCTCGAGACACACTTCACTTGGCATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173609.1-1120s1c1
Sequence:CCGGCCAAGTGAAGTGTGTGCATTTCTCGAGAAATGCACACACTTCACTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173609.1-1119s1c1
Sequence:CCGGGCCAAGTGAAGTGTGTGCATTCTCGAGAATGCACACACTTCACTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173609.1-912s1c1
Sequence:CCGGGAACTGCAGAGAAGATCCACACTCGAGTGTGGATCTTCTCTGCAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173609.1-765s1c1
Sequence:CCGGGTGTGAAGAAGAAGAGGCGATCTCGAGATCGCCTCTTCTTCTTCACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128036    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173609.1-1097s1c1
Sequence:CCGGGAAAGCTAAAGGTGCTGGAGACTCGAGTCTCCAGCACCTTTAGCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173609.1-714s1c1
Sequence:CCGGGCATTTACTTCTCTGGCTACACTCGAGTGTAGCCAGAGAAGTAAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173609
HMGN2P46 MISSION shRNA Lentiviral Transduction Particles
high mobility group nucleosomal binding domain 2 pseudogene 46
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130847    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173609.1-925s1c1
Sequence:CCGGGATCCACAAGGTTGTCTGCTACTCGAGTAGCAGACAACCTTGTGGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130752    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173609.1-1114s1c1
Sequence:CCGGGAGATGCCAAGTGAAGTGTGTCTCGAGACACACTTCACTTGGCATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173609.1-1120s1c1
Sequence:CCGGCCAAGTGAAGTGTGTGCATTTCTCGAGAAATGCACACACTTCACTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173609.1-1119s1c1
Sequence:CCGGGCCAAGTGAAGTGTGTGCATTCTCGAGAATGCACACACTTCACTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173609.1-912s1c1
Sequence:CCGGGAACTGCAGAGAAGATCCACACTCGAGTGTGGATCTTCTCTGCAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173609.1-765s1c1
Sequence:CCGGGTGTGAAGAAGAAGAGGCGATCTCGAGATCGCCTCTTCTTCTTCACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128036    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173609.1-1097s1c1
Sequence:CCGGGAAAGCTAAAGGTGCTGGAGACTCGAGTCTCCAGCACCTTTAGCTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173609.1-714s1c1
Sequence:CCGGGCATTTACTTCTCTGGCTACACTCGAGTGTAGCCAGAGAAGTAAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)