EMAIL THIS PAGE TO A FRIEND

HMGN4

high mobility group nucleosomal binding domain 4

32 Gene Product Result for
Synonyms: HMG17L3 NHC
UniProtKB ID: O00479, B2R4I6, Q53XL9
Gene ID:
Human(10473) Summary: The protein encoded by this gene, a member of the HMGN protein family, is thought to reduce the compactness of the chromatin fiber in nucleosomes, thereby enhancing transcription from chromatin templates. [provided by RefSeq, Mar 2013]
cow(786256) high mobility group nucleosomal binding domain 4
domestic cat(101087991) high mobility group nucleosomal binding domain 4
cow(614918) high mobility group nucleosomal binding domain 4
domestic guinea pig(100735271) high mobility group nucleosomal binding domain 4
naked mole-rat(101726503) high mobility group nucleosomal binding domain 4
sheep(101107313) high mobility group nucleosomal binding domain 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302632 ANTI-HMGN4 (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006353 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006353 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006353 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU004561 MISSION® esiRNA esiRNA targeting human HMGN4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006353 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006353 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00136674 predicted 288
2 SASI_Hs01_00136675 predicted 771
3 SASI_Hs01_00136676 predicted 868
4 SASI_Hs01_00136677 predicted 680
5 SASI_Hs01_00136678 predicted 546
6 SASI_Hs02_00341394 predicted 258
7 SASI_Hs01_00136679 predicted 681
8 SASI_Hs01_00136680 predicted 779
9 SASI_Hs01_00136681 predicted 528
10 SASI_Hs01_00136682 predicted 876
11 SASI_Hs01_00136683 predicted 392
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006353
VALIDATED
HMGN4 MISSION shRNA Bacterial Glycerol Stock
high mobility group nucleosomal binding domain 4
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000234488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006353.2-293s21c1
Sequence:CCGGGATGAGCCACAGAGGAGATCACTCGAGTGATCTCCTCTGTGGCTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233401    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006353.2-1442s21c1
Sequence:CCGGTGGTTGTCTCTGCACTATTTACTCGAGTAAATAGTGCAGAGACAACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_006353.2-464s21c1
Sequence:CCGGTCTACACTCCAGTCCCAGAAACTCGAGTTTCTGGGACTGGAGTGTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006353.2-502s21c1
Sequence:CCGGTGCCAAGTGAAATGTACATTTCTCGAGAAATGTACATTTCACTTGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006353.2-370s1c1
Sequence:CCGGCTCTGCAAAGAAGGGAGAGAACTCGAGTTCTCTCCCTTCTTTGCAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_006353.2-311s1c1
Sequence:CCGGTCAGCTCGGTTGTCTGCTAAACTCGAGTTTAGCAGACAACCGAGCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_006353.2-464s1c1
Sequence:CCGGTCTACACTCCAGTCCCAGAAACTCGAGTTTCTGGGACTGGAGTGTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006353.2-311s21c1
Sequence:CCGGTCAGCTCGGTTGTCTGCTAAACTCGAGTTTAGCAGACAACCGAGCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006353.2-430s21c1
Sequence:CCGGGGATGGGAACAACCCTGCAAACTCGAGTTTGCAGGGTTGTTCCCATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115687    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006353.2-1753s1c1
Sequence:CCGGCCTCCATATTACTTCTAGAATCTCGAGATTCTAGAAGTAATATGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006353.2-275s1c1
Sequence:CCGGGATAAAGCAAAGGTGAAGGATCTCGAGATCCTTCACCTTTGCTTTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006353
VALIDATED
HMGN4 MISSION shRNA shRNA Plasmid DNA
high mobility group nucleosomal binding domain 4
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000234488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006353.2-293s21c1
Sequence:CCGGGATGAGCCACAGAGGAGATCACTCGAGTGATCTCCTCTGTGGCTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233401    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006353.2-1442s21c1
Sequence:CCGGTGGTTGTCTCTGCACTATTTACTCGAGTAAATAGTGCAGAGACAACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_006353.2-464s21c1
Sequence:CCGGTCTACACTCCAGTCCCAGAAACTCGAGTTTCTGGGACTGGAGTGTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006353.2-502s21c1
Sequence:CCGGTGCCAAGTGAAATGTACATTTCTCGAGAAATGTACATTTCACTTGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006353.2-370s1c1
Sequence:CCGGCTCTGCAAAGAAGGGAGAGAACTCGAGTTCTCTCCCTTCTTTGCAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_006353.2-311s1c1
Sequence:CCGGTCAGCTCGGTTGTCTGCTAAACTCGAGTTTAGCAGACAACCGAGCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_006353.2-464s1c1
Sequence:CCGGTCTACACTCCAGTCCCAGAAACTCGAGTTTCTGGGACTGGAGTGTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006353.2-311s21c1
Sequence:CCGGTCAGCTCGGTTGTCTGCTAAACTCGAGTTTAGCAGACAACCGAGCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006353.2-430s21c1
Sequence:CCGGGGATGGGAACAACCCTGCAAACTCGAGTTTGCAGGGTTGTTCCCATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115687    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006353.2-1753s1c1
Sequence:CCGGCCTCCATATTACTTCTAGAATCTCGAGATTCTAGAAGTAATATGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006353.2-275s1c1
Sequence:CCGGGATAAAGCAAAGGTGAAGGATCTCGAGATCCTTCACCTTTGCTTTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006353
VALIDATED
HMGN4 MISSION shRNA Lentiviral Transduction Particles
high mobility group nucleosomal binding domain 4
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000234488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006353.2-293s21c1
Sequence:CCGGGATGAGCCACAGAGGAGATCACTCGAGTGATCTCCTCTGTGGCTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233401    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006353.2-1442s21c1
Sequence:CCGGTGGTTGTCTCTGCACTATTTACTCGAGTAAATAGTGCAGAGACAACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_006353.2-464s21c1
Sequence:CCGGTCTACACTCCAGTCCCAGAAACTCGAGTTTCTGGGACTGGAGTGTAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006353.2-502s21c1
Sequence:CCGGTGCCAAGTGAAATGTACATTTCTCGAGAAATGTACATTTCACTTGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006353.2-370s1c1
Sequence:CCGGCTCTGCAAAGAAGGGAGAGAACTCGAGTTCTCTCCCTTCTTTGCAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_006353.2-311s1c1
Sequence:CCGGTCAGCTCGGTTGTCTGCTAAACTCGAGTTTAGCAGACAACCGAGCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_006353.2-464s1c1
Sequence:CCGGTCTACACTCCAGTCCCAGAAACTCGAGTTTCTGGGACTGGAGTGTAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006353.2-311s21c1
Sequence:CCGGTCAGCTCGGTTGTCTGCTAAACTCGAGTTTAGCAGACAACCGAGCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006353.2-430s21c1
Sequence:CCGGGGATGGGAACAACCCTGCAAACTCGAGTTTGCAGGGTTGTTCCCATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115687    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006353.2-1753s1c1
Sequence:CCGGCCTCCATATTACTTCTAGAATCTCGAGATTCTAGAAGTAATATGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006353.2-275s1c1
Sequence:CCGGGATAAAGCAAAGGTGAAGGATCTCGAGATCCTTCACCTTTGCTTTATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)