EMAIL THIS PAGE TO A FRIEND

HMGN5

high mobility group nucleosome binding domain 5

73 Gene Product Result for
Synonyms: NBP-45 NSBP1
UniProtKB ID: P82970, Q5JSL1
Gene ID:
Human(79366) Summary: This gene encodes a nuclear protein with similarities to the high mobility group proteins, HMG14 and HMG17, which suggests that this protein may function as a nucleosomal binding and transcriptional activating protein. [provided by RefSeq, Sep 2009]
Mouse(50887) high-mobility group nucleosome binding domain 5
Rat(100910616) high mobility group nucleosome-binding domain-containing protein 5
sheep(101108552) high mobility group nucleosome binding domain 5
chicken(422278) high mobility group nucleosome binding domain 5
cow(767875) high mobility group nucleosome binding domain 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016710 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016710 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016710 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_030763 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030763 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030763 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU083251 MISSION® esiRNA esiRNA human NSBP1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030763 Rosetta Predictions human pricing
NM_016710 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030763 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00086190 predicted 1329
2 SASI_Hs01_00086191 predicted 1263
3 SASI_Hs01_00086192 predicted 1334
4 SASI_Hs01_00086193 predicted 1248
5 SASI_Hs01_00086194 predicted 1259
6 SASI_Hs01_00086195 predicted 1309
7 SASI_Hs01_00086196 predicted 1330
8 SASI_Hs01_00086197 predicted 1317
9 SASI_Hs01_00086198 predicted 1210
10 SASI_Hs01_00086199 predicted 1224
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016710 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00323390 predicted 1661
2 SASI_Mm02_00323391 predicted 1666
3 SASI_Mm02_00323392 predicted 1447
4 SASI_Mm02_00323393 predicted 1490
5 SASI_Mm02_00323394 predicted 1578
6 SASI_Mm02_00323395 predicted 1549
7 SASI_Mm02_00323396 predicted 220
8 SASI_Mm02_00323397 predicted 1678
9 SASI_Mm02_00323398 predicted 1661
10 SASI_Mm02_00323399 predicted 1571
11 SASI_Mm01_00028741 predicted 1332
12 SASI_Mm01_00028742 predicted 1356
13 SASI_Mm01_00028743 predicted 256
14 SASI_Mm01_00028744 predicted 968
15 SASI_Mm01_00028745 predicted 232
16 SASI_Mm01_00028746 predicted 1123
17 SASI_Mm01_00028747 predicted 908
18 SASI_Mm01_00028748 predicted 1367
19 SASI_Mm01_00028749 predicted 283
20 SASI_Mm01_00028750 predicted 263
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016710
HMGN5 MISSION shRNA Bacterial Glycerol Stock
high mobility group nucleosome binding domain 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000124335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016710.1-392s1c1
Sequence:CCGGCAGATAAATGAAGACACTGAACTCGAGTTCAGTGTCTTCATTTATCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016710.1-264s1c1
Sequence:CCGGCCATACCAATTCCTGAAACCACTCGAGTGGTTTCAGGAATTGGTATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016710.1-602s1c1
Sequence:CCGGGCAGAGGTGTCCAAAGATGAACTCGAGTTCATCTTTGGACACCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124334    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016710.1-1474s1c1
Sequence:CCGGGCCTAACATGACACCTTTATACTCGAGTATAAAGGTGTCATGTTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016710.1-253s1c1
Sequence:CCGGAGATGCAAGTACCATACCAATCTCGAGATTGGTATGGTACTTGCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016710
HMGN5 MISSION shRNA shRNA Plasmid DNA
high mobility group nucleosome binding domain 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000124335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016710.1-392s1c1
Sequence:CCGGCAGATAAATGAAGACACTGAACTCGAGTTCAGTGTCTTCATTTATCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016710.1-264s1c1
Sequence:CCGGCCATACCAATTCCTGAAACCACTCGAGTGGTTTCAGGAATTGGTATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016710.1-602s1c1
Sequence:CCGGGCAGAGGTGTCCAAAGATGAACTCGAGTTCATCTTTGGACACCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124334    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016710.1-1474s1c1
Sequence:CCGGGCCTAACATGACACCTTTATACTCGAGTATAAAGGTGTCATGTTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016710.1-253s1c1
Sequence:CCGGAGATGCAAGTACCATACCAATCTCGAGATTGGTATGGTACTTGCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016710
HMGN5 MISSION shRNA Lentiviral Transduction Particles
high mobility group nucleosome binding domain 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000124335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016710.1-392s1c1
Sequence:CCGGCAGATAAATGAAGACACTGAACTCGAGTTCAGTGTCTTCATTTATCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016710.1-264s1c1
Sequence:CCGGCCATACCAATTCCTGAAACCACTCGAGTGGTTTCAGGAATTGGTATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016710.1-602s1c1
Sequence:CCGGGCAGAGGTGTCCAAAGATGAACTCGAGTTCATCTTTGGACACCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124334    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016710.1-1474s1c1
Sequence:CCGGGCCTAACATGACACCTTTATACTCGAGTATAAAGGTGTCATGTTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016710.1-253s1c1
Sequence:CCGGAGATGCAAGTACCATACCAATCTCGAGATTGGTATGGTACTTGCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030763
VALIDATED
HMGN5 MISSION shRNA Bacterial Glycerol Stock
high mobility group nucleosome binding domain 5
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000342943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030763.2-513s21c1
Sequence:CCGGGCAGTTGCTGAAACCAAGCAACTCGAGTTGCTTGGTTTCAGCAACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030763.1-279s1c1
Sequence:CCGGGTTGTTGAAGAAGACTACAATCTCGAGATTGTAGTCTTCTTCAACAACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A3
TRC Version: 1 Clone ID:NM_030763.1-252s1c1
Sequence:CCGGGCAGTTGCTGAAACCAAGCAACTCGAGTTGCTTGGTTTCAGCAACTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030763.1-138s1c1
Sequence:CCGGTCTGCTATGCTTGTGCCAGTTCTCGAGAACTGGCACAAGCATAGCAGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_030763.1-895s1c1
Sequence:CCGGAGGAGCCACAGAGTATTGTTTCTCGAGAAACAATACTCTGTGGCTCCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030763.1-869s1c1
Sequence:CCGGGATCAAAGAAGATGATGGAAACTCGAGTTTCCATCATCTTCTTTGATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030763.2-399s21c1
Sequence:CCGGTCTGCTATGCTTGTGCCAGTTCTCGAGAACTGGCACAAGCATAGCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030763.2-1130s21c1
Sequence:CCGGGATCAAAGAAGATGATGGAAACTCGAGTTTCCATCATCTTCTTTGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030763.2-540s21c1
Sequence:CCGGGTTGTTGAAGAAGACTACAATCTCGAGATTGTAGTCTTCTTCAACAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030763
VALIDATED
HMGN5 MISSION shRNA shRNA Plasmid DNA
high mobility group nucleosome binding domain 5
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000342943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030763.2-513s21c1
Sequence:CCGGGCAGTTGCTGAAACCAAGCAACTCGAGTTGCTTGGTTTCAGCAACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030763.1-279s1c1
Sequence:CCGGGTTGTTGAAGAAGACTACAATCTCGAGATTGTAGTCTTCTTCAACAACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A3
TRC Version: 1 Clone ID:NM_030763.1-252s1c1
Sequence:CCGGGCAGTTGCTGAAACCAAGCAACTCGAGTTGCTTGGTTTCAGCAACTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030763.1-138s1c1
Sequence:CCGGTCTGCTATGCTTGTGCCAGTTCTCGAGAACTGGCACAAGCATAGCAGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_030763.1-895s1c1
Sequence:CCGGAGGAGCCACAGAGTATTGTTTCTCGAGAAACAATACTCTGTGGCTCCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030763.1-869s1c1
Sequence:CCGGGATCAAAGAAGATGATGGAAACTCGAGTTTCCATCATCTTCTTTGATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030763.2-399s21c1
Sequence:CCGGTCTGCTATGCTTGTGCCAGTTCTCGAGAACTGGCACAAGCATAGCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030763.2-1130s21c1
Sequence:CCGGGATCAAAGAAGATGATGGAAACTCGAGTTTCCATCATCTTCTTTGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030763.2-540s21c1
Sequence:CCGGGTTGTTGAAGAAGACTACAATCTCGAGATTGTAGTCTTCTTCAACAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030763
VALIDATED
HMGN5 MISSION shRNA Lentiviral Transduction Particles
high mobility group nucleosome binding domain 5
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000342943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030763.2-513s21c1
Sequence:CCGGGCAGTTGCTGAAACCAAGCAACTCGAGTTGCTTGGTTTCAGCAACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030763.1-279s1c1
Sequence:CCGGGTTGTTGAAGAAGACTACAATCTCGAGATTGTAGTCTTCTTCAACAACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A3
TRC Version: 1 Clone ID:NM_030763.1-252s1c1
Sequence:CCGGGCAGTTGCTGAAACCAAGCAACTCGAGTTGCTTGGTTTCAGCAACTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030763.1-138s1c1
Sequence:CCGGTCTGCTATGCTTGTGCCAGTTCTCGAGAACTGGCACAAGCATAGCAGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_030763.1-895s1c1
Sequence:CCGGAGGAGCCACAGAGTATTGTTTCTCGAGAAACAATACTCTGTGGCTCCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030763.1-869s1c1
Sequence:CCGGGATCAAAGAAGATGATGGAAACTCGAGTTTCCATCATCTTCTTTGATCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030763.2-399s21c1
Sequence:CCGGTCTGCTATGCTTGTGCCAGTTCTCGAGAACTGGCACAAGCATAGCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030763.2-1130s21c1
Sequence:CCGGGATCAAAGAAGATGATGGAAACTCGAGTTTCCATCATCTTCTTTGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030763.2-540s21c1
Sequence:CCGGGTTGTTGAAGAAGACTACAATCTCGAGATTGTAGTCTTCTTCAACAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)