EMAIL THIS PAGE TO A FRIEND

HMGXB3

HMG box domain containing 3

125 Gene Product Result for
Synonyms: HMGX3 SMF
UniProtKB ID: Q12766, G5E9Y4, Q86UG3, Q9UMF4
Gene ID:
Human(22993) Summary: This gene is one of the non-canonical high mobility group (HMG) genes. The encoded protein contains an HMG-box domain found in DNA binding proteins such as transcription factors and chromosomal proteins. [provided by RefSeq, Aug 2011]
Mouse(106894) HMG box domain containing 3
Rat(361335) HMG box domain containing 3
chicken(416278) HMG box domain containing 3
domestic cat(101086951) HMG box domain containing 3
cow(509419) HMG box domain containing 3
Horse(100071672) HMG box domain containing 3
dog(479330) HMG box domain containing 3
domestic guinea pig(100725778) HMG box domain containing 3
naked mole-rat(101720576) HMG box domain containing 3
sheep(101122520) HMG box domain containing 3
Domestic Rabbit(100340736) HMG box domain containing 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014983 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014983 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014983 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_134134 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_134134 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_134134 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU082391 MISSION® esiRNA esiRNA targeting mouse A630042L21Rik (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001714730 Rosetta Predictions human pricing
XM_001717202 Rosetta Predictions human pricing
XM_001717459 Rosetta Predictions human pricing
XM_001057752 Rosetta Predictions rat pricing
XM_001057816 Rosetta Predictions rat pricing
XM_341620 Rosetta Predictions rat pricing
NM_134134 Rosetta Predictions mouse pricing
NM_178277 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001714730 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00399033 predicted 4211
2 SASI_Hs02_00399034 predicted 3151
3 SASI_Hs02_00399035 predicted 3507
4 SASI_Hs02_00399036 predicted 1056
5 SASI_Hs02_00399037 predicted 1531
6 SASI_Hs02_00399038 predicted 2063
7 SASI_Hs02_00399039 predicted 2953
8 SASI_Hs02_00399040 predicted 2539
9 SASI_Hs02_00399041 predicted 3869
10 SASI_Hs02_00399042 predicted 3913
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001717202 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00415670 predicted 4223
2 SASI_Hs02_00415671 predicted 3173
3 SASI_Hs02_00415672 predicted 3517
4 SASI_Hs02_00415673 predicted 1076
5 SASI_Hs02_00415674 predicted 1548
6 SASI_Hs02_00415675 predicted 2077
7 SASI_Hs02_00415676 predicted 2964
8 SASI_Hs02_00415677 predicted 2555
9 SASI_Hs02_00415678 predicted 3879
10 SASI_Hs02_00415679 predicted 3920
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001717459 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00417354 predicted 4227
2 SASI_Hs02_00417355 predicted 3171
3 SASI_Hs02_00417356 predicted 3522
4 SASI_Hs02_00417357 predicted 1075
5 SASI_Hs02_00417358 predicted 1546
6 SASI_Hs02_00417359 predicted 2080
7 SASI_Hs02_00417360 predicted 2967
8 SASI_Hs02_00417361 predicted 2558
9 SASI_Hs02_00417362 predicted 3878
10 SASI_Hs02_00417363 predicted 3928
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057752 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00287449 predicted 763
2 SASI_Rn02_00287450 predicted 2199
3 SASI_Rn02_00287451 predicted 343
4 SASI_Rn02_00287452 predicted 904
5 SASI_Rn02_00287453 predicted 2585
6 SASI_Rn02_00287454 predicted 657
7 SASI_Rn02_00287455 predicted 2576
8 SASI_Rn02_00287456 predicted 1841
9 SASI_Rn02_00287457 predicted 2848
10 SASI_Rn02_00287458 predicted 1599
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057816 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00287656 predicted 1691
2 SASI_Rn02_00287657 predicted 3138
3 SASI_Rn02_00287658 predicted 1276
4 SASI_Rn02_00287659 predicted 719
5 SASI_Rn02_00287660 predicted 1597
6 SASI_Rn02_00287661 predicted 3507
7 SASI_Rn02_00287662 predicted 2781
8 SASI_Rn02_00287663 predicted 459
9 SASI_Rn02_00287664 predicted 3779
10 SASI_Rn02_00287665 predicted 2624
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341620 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00159587 predicted 1784
2 SASI_Rn01_00159588 predicted 1365
3 SASI_Rn01_00159589 predicted 810
4 SASI_Rn01_00159590 predicted 3341
5 SASI_Rn01_00159591 predicted 1686
6 SASI_Rn01_00159592 predicted 3138
7 SASI_Rn01_00159593 predicted 553
8 SASI_Rn01_00159594 predicted 2710
9 SASI_Rn01_00159595 predicted 2023
10 SASI_Rn01_00159596 predicted 648
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134134 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00339379 predicted 1331
2 SASI_Mm01_00183281 predicted 2742
3 SASI_Mm02_00339380 predicted 486
4 SASI_Mm01_00183284 predicted 3617
5 SASI_Mm01_00183285 predicted 2500
6 SASI_Mm02_00339381 predicted 1174
7 SASI_Mm02_00339382 predicted 777
8 SASI_Mm01_00183286 predicted 3482
9 SASI_Mm01_00183287 predicted 3213
10 SASI_Mm02_00339383 predicted 512
11 SASI_Mm01_00183280 predicted 3478
12 SASI_Mm01_00183282 predicted 2394
13 SASI_Mm01_00183283 predicted 2995
14 SASI_Mm01_00183288 predicted 2584
15 SASI_Mm01_00183289 predicted 2777
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178277 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00348716 predicted 1339
2 SASI_Mm02_00348717 predicted 2833
3 SASI_Mm02_00348718 predicted 479
4 SASI_Mm02_00348719 predicted 3706
5 SASI_Mm02_00348720 predicted 2590
6 SASI_Mm02_00348721 predicted 1182
7 SASI_Mm02_00348722 predicted 772
8 SASI_Mm02_00348723 predicted 3576
9 SASI_Mm02_00348724 predicted 3307
10 SASI_Mm02_00348725 predicted 516
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014983
VALIDATED
HMGXB3 MISSION shRNA Bacterial Glycerol Stock
HMG box domain containing 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000352414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_014983.2-2779s21c1
Sequence:CCGGCAAACCTCTTGGTCGAATTATCTCGAGATAATTCGACCAAGAGGTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_014983.2-2721s21c1
Sequence:CCGGACTCAACAGCTCTCGACTTATCTCGAGATAAGTCGAGAGCTGTTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352316    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014983.2-4482s21c1
Sequence:CCGGCATCTCTCAAGCCATAGTAAGCTCGAGCTTACTATGGCTTGAGAGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_014983.2-4243s21c1
Sequence:CCGGGACAATGCCACTCACTATTACCTCGAGGTAATAGTGAGTGGCATTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_014983.2-718s21c1
Sequence:CCGGGCTTACCTTCTGTACTATTACCTCGAGGTAATAGTACAGAAGGTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014983
VALIDATED
HMGXB3 MISSION shRNA shRNA Plasmid DNA
HMG box domain containing 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000352414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_014983.2-2779s21c1
Sequence:CCGGCAAACCTCTTGGTCGAATTATCTCGAGATAATTCGACCAAGAGGTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_014983.2-2721s21c1
Sequence:CCGGACTCAACAGCTCTCGACTTATCTCGAGATAAGTCGAGAGCTGTTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352316    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014983.2-4482s21c1
Sequence:CCGGCATCTCTCAAGCCATAGTAAGCTCGAGCTTACTATGGCTTGAGAGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_014983.2-4243s21c1
Sequence:CCGGGACAATGCCACTCACTATTACCTCGAGGTAATAGTGAGTGGCATTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_014983.2-718s21c1
Sequence:CCGGGCTTACCTTCTGTACTATTACCTCGAGGTAATAGTACAGAAGGTAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014983
VALIDATED
HMGXB3 MISSION shRNA Lentiviral Transduction Particles
HMG box domain containing 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000352414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_014983.2-2779s21c1
Sequence:CCGGCAAACCTCTTGGTCGAATTATCTCGAGATAATTCGACCAAGAGGTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_014983.2-2721s21c1
Sequence:CCGGACTCAACAGCTCTCGACTTATCTCGAGATAAGTCGAGAGCTGTTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352316    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014983.2-4482s21c1
Sequence:CCGGCATCTCTCAAGCCATAGTAAGCTCGAGCTTACTATGGCTTGAGAGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_014983.2-4243s21c1
Sequence:CCGGGACAATGCCACTCACTATTACCTCGAGGTAATAGTGAGTGGCATTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_014983.2-718s21c1
Sequence:CCGGGCTTACCTTCTGTACTATTACCTCGAGGTAATAGTACAGAAGGTAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_134134
HMGXB3 MISSION shRNA Bacterial Glycerol Stock
HMG box domain containing 3
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000302918    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134134.2-4623s21c1
Sequence:CCGGCCTGCCTTGCTGGCTTATTTACTCGAGTAAATAAGCCAGCAAGGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134134.2-3811s21c1
Sequence:CCGGCCAGCATTATTCTGTGGATGTCTCGAGACATCCACAGAATAATGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134134.2-2091s21c1
Sequence:CCGGGCACTGGTGAAGTAAAGCTATCTCGAGATAGCTTTACTTCACCAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134134.2-2575s21c1
Sequence:CCGGGCAGACCTCTTGGTCGAATTACTCGAGTAATTCGACCAAGAGGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098865    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134134.1-4626s1c1
Sequence:CCGGCCTGCCTTGCTGGCTTATTTACTCGAGTAAATAAGCCAGCAAGGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134134.1-2092s1c1
Sequence:CCGGGCACTGGTGAAGTAAAGCTATCTCGAGATAGCTTTACTTCACCAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134134.1-2576s1c1
Sequence:CCGGGCAGACCTCTTGGTCGAATTACTCGAGTAATTCGACCAAGAGGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134134.1-3657s1c1
Sequence:CCGGCCACCTGTCTATGTGGTAGATCTCGAGATCTACCACATAGACAGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134134.1-3812s1c1
Sequence:CCGGCCAGCATTATTCTGTGGATGTCTCGAGACATCCACAGAATAATGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_134134
HMGXB3 MISSION shRNA shRNA Plasmid DNA
HMG box domain containing 3
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000302918    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134134.2-4623s21c1
Sequence:CCGGCCTGCCTTGCTGGCTTATTTACTCGAGTAAATAAGCCAGCAAGGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134134.2-3811s21c1
Sequence:CCGGCCAGCATTATTCTGTGGATGTCTCGAGACATCCACAGAATAATGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134134.2-2091s21c1
Sequence:CCGGGCACTGGTGAAGTAAAGCTATCTCGAGATAGCTTTACTTCACCAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134134.2-2575s21c1
Sequence:CCGGGCAGACCTCTTGGTCGAATTACTCGAGTAATTCGACCAAGAGGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098865    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134134.1-4626s1c1
Sequence:CCGGCCTGCCTTGCTGGCTTATTTACTCGAGTAAATAAGCCAGCAAGGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134134.1-2092s1c1
Sequence:CCGGGCACTGGTGAAGTAAAGCTATCTCGAGATAGCTTTACTTCACCAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134134.1-2576s1c1
Sequence:CCGGGCAGACCTCTTGGTCGAATTACTCGAGTAATTCGACCAAGAGGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134134.1-3657s1c1
Sequence:CCGGCCACCTGTCTATGTGGTAGATCTCGAGATCTACCACATAGACAGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134134.1-3812s1c1
Sequence:CCGGCCAGCATTATTCTGTGGATGTCTCGAGACATCCACAGAATAATGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_134134
HMGXB3 MISSION shRNA Lentiviral Transduction Particles
HMG box domain containing 3
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000302918    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134134.2-4623s21c1
Sequence:CCGGCCTGCCTTGCTGGCTTATTTACTCGAGTAAATAAGCCAGCAAGGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134134.2-3811s21c1
Sequence:CCGGCCAGCATTATTCTGTGGATGTCTCGAGACATCCACAGAATAATGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134134.2-2091s21c1
Sequence:CCGGGCACTGGTGAAGTAAAGCTATCTCGAGATAGCTTTACTTCACCAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134134.2-2575s21c1
Sequence:CCGGGCAGACCTCTTGGTCGAATTACTCGAGTAATTCGACCAAGAGGTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098865    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134134.1-4626s1c1
Sequence:CCGGCCTGCCTTGCTGGCTTATTTACTCGAGTAAATAAGCCAGCAAGGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134134.1-2092s1c1
Sequence:CCGGGCACTGGTGAAGTAAAGCTATCTCGAGATAGCTTTACTTCACCAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134134.1-2576s1c1
Sequence:CCGGGCAGACCTCTTGGTCGAATTACTCGAGTAATTCGACCAAGAGGTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134134.1-3657s1c1
Sequence:CCGGCCACCTGTCTATGTGGTAGATCTCGAGATCTACCACATAGACAGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134134.1-3812s1c1
Sequence:CCGGCCAGCATTATTCTGTGGATGTCTCGAGACATCCACAGAATAATGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)