EMAIL THIS PAGE TO A FRIEND

HMGXB4

HMG box domain containing 4

192 Gene Product Result for
Synonyms: HMG2L1 HMGBCG THC211630
UniProtKB ID: Q9UGU5, O75672, O75673, Q9UMT5
Gene ID:
Human(10042) Summary: High mobility group (HMG) proteins are nonhistone chromosomal proteins. See HMG2 (MIM 163906) for additional information on HMG proteins.[supplied by OMIM, Nov 2010]
Mouse(70823) HMG box domain containing 4
Rat(307667) HMG box domain containing 4
sheep(101120401) HMG box domain containing 4
Domestic Rabbit(100345748) HMG box domain containing 4
domestic guinea pig(100712693) HMG box domain containing 4
naked mole-rat(101711137) HMG box domain containing 4
chicken(418059) HMG box domain containing 4
cow(505539) HMG box domain containing 4
Horse(100054243) HMG box domain containing 4
domestic cat(101091956) HMG box domain containing 4
dog(481285) HMG box domain containing 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005487 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005487 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005487 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178017 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178017 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178017 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU154941 MISSION® esiRNA esiRNA human HMGXB4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001003681 Rosetta Predictions human pricing
NM_005487 Rosetta Predictions human pricing
NM_014250 Rosetta Predictions human pricing
NM_001107412 Rosetta Predictions rat pricing
NM_178017 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003681 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00183502 predicted 738
2 SASI_Hs01_00183504 predicted 2372
3 SASI_Hs01_00183505 predicted 2327
4 SASI_Hs01_00183506 predicted 1686
5 SASI_Hs01_00183507 predicted 1723
6 SASI_Hs02_00304315 predicted 1568
7 SASI_Hs01_00183508 predicted 2399
8 SASI_Hs01_00183510 predicted 1674
9 SASI_Hs01_00183511 predicted 2377
10 SASI_Hs02_00304316 predicted 2333
11 SASI_Hs01_00183503 predicted 1796
12 SASI_Hs01_00183509 predicted 2359
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005487 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00050304 predicted 850
2 SASI_Hs01_00050306 predicted 2491
3 SASI_Hs01_00050307 predicted 2444
4 SASI_Hs01_00050308 predicted 1801
5 SASI_Hs01_00050309 predicted 1841
6 SASI_Hs02_00339678 predicted 1680
7 SASI_Hs01_00050310 predicted 2513
8 SASI_Hs01_00050312 predicted 1792
9 SASI_Hs01_00050313 predicted 2493
10 SASI_Hs02_00339679 predicted 2448
11 SASI_Hs01_00050305 predicted 1903
12 SASI_Hs01_00050311 predicted 2466
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014250 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00146526 predicted 748
2 SASI_Hs01_00146528 predicted 2388
3 SASI_Hs01_00146529 predicted 2341
4 SASI_Hs01_00146530 predicted 1697
5 SASI_Hs01_00146531 predicted 1737
6 SASI_Hs02_00345307 predicted 1578
7 SASI_Hs01_00146532 predicted 2416
8 SASI_Hs01_00146534 predicted 1692
9 SASI_Hs01_00146535 predicted 2394
10 SASI_Hs02_00345308 predicted 2348
11 SASI_Hs01_00146527 predicted 1808
12 SASI_Hs01_00146533 predicted 2375
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107412 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00228565 predicted 1681
2 SASI_Rn02_00228566 predicted 1859
3 SASI_Rn02_00228567 predicted 529
4 SASI_Rn02_00228568 predicted 700
5 SASI_Rn02_00228569 predicted 244
6 SASI_Rn02_00228570 predicted 1843
7 SASI_Rn02_00228571 predicted 712
8 SASI_Rn02_00228572 predicted 802
9 SASI_Rn02_00228573 predicted 437
10 SASI_Rn02_00228574 predicted 644
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178017 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00054776 predicted 809
2 SASI_Mm01_00054777 predicted 775
3 SASI_Mm01_00054778 predicted 1838
4 SASI_Mm01_00054779 predicted 219
5 SASI_Mm01_00054780 predicted 1882
6 SASI_Mm01_00054781 predicted 683
7 SASI_Mm01_00054782 predicted 284
8 SASI_Mm01_00054783 predicted 691
9 SASI_Mm01_00054784 predicted 1870
10 SASI_Mm01_00054785 predicted 436
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005487
HMGXB4 MISSION shRNA Bacterial Glycerol Stock
HMG box domain containing 4
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000234506    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005487.3-3590s21c1
Sequence:CCGGAGCCCATCTGCATCCTATTTACTCGAGTAAATAGGATGCAGATGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005487.2-1480s1c1
Sequence:CCGGCCAGGTGTTCTGTAAAGAGTACTCGAGTACTCTTTACAGAACACCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005487.2-849s1c1
Sequence:CCGGGCTCTGTTGATGAGGAGTCTTCTCGAGAAGACTCCTCATCAACAGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005487.2-1616s1c1
Sequence:CCGGGCTCAGTATCTGCAGCACAAACTCGAGTTTGTGCTGCAGATACTGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005487.2-1799s1c1
Sequence:CCGGCCCATTGATGTTGCTGCTCATCTCGAGATGAGCAGCAACATCAATGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005487.2-1263s1c1
Sequence:CCGGCCAAGAGAAGTTTAGGACTTTCTCGAGAAAGTCCTAAACTTCTCTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005487.3-797s21c1
Sequence:CCGGTCGGGAGCCTGATGGTTTAAACTCGAGTTTAAACCATCAGGCTCCCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005487.3-1526s21c1
Sequence:CCGGTGACCATCCAGGTATAGATTTCTCGAGAAATCTATACCTGGATGGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005487.3-1095s21c1
Sequence:CCGGCTTTCAGGGCTTGAACCTATTCTCGAGAATAGGTTCAAGCCCTGAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005487.3-657s21c1
Sequence:CCGGTCAAGCCATTCGGAGAGTAAACTCGAGTTTACTCTCCGAATGGCTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005487
HMGXB4 MISSION shRNA shRNA Plasmid DNA
HMG box domain containing 4
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000234506    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005487.3-3590s21c1
Sequence:CCGGAGCCCATCTGCATCCTATTTACTCGAGTAAATAGGATGCAGATGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005487.2-1480s1c1
Sequence:CCGGCCAGGTGTTCTGTAAAGAGTACTCGAGTACTCTTTACAGAACACCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005487.2-849s1c1
Sequence:CCGGGCTCTGTTGATGAGGAGTCTTCTCGAGAAGACTCCTCATCAACAGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005487.2-1616s1c1
Sequence:CCGGGCTCAGTATCTGCAGCACAAACTCGAGTTTGTGCTGCAGATACTGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005487.2-1799s1c1
Sequence:CCGGCCCATTGATGTTGCTGCTCATCTCGAGATGAGCAGCAACATCAATGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005487.2-1263s1c1
Sequence:CCGGCCAAGAGAAGTTTAGGACTTTCTCGAGAAAGTCCTAAACTTCTCTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005487.3-797s21c1
Sequence:CCGGTCGGGAGCCTGATGGTTTAAACTCGAGTTTAAACCATCAGGCTCCCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005487.3-1526s21c1
Sequence:CCGGTGACCATCCAGGTATAGATTTCTCGAGAAATCTATACCTGGATGGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005487.3-1095s21c1
Sequence:CCGGCTTTCAGGGCTTGAACCTATTCTCGAGAATAGGTTCAAGCCCTGAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005487.3-657s21c1
Sequence:CCGGTCAAGCCATTCGGAGAGTAAACTCGAGTTTACTCTCCGAATGGCTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005487
HMGXB4 MISSION shRNA Lentiviral Transduction Particles
HMG box domain containing 4
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000234506    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005487.3-3590s21c1
Sequence:CCGGAGCCCATCTGCATCCTATTTACTCGAGTAAATAGGATGCAGATGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005487.2-1480s1c1
Sequence:CCGGCCAGGTGTTCTGTAAAGAGTACTCGAGTACTCTTTACAGAACACCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005487.2-849s1c1
Sequence:CCGGGCTCTGTTGATGAGGAGTCTTCTCGAGAAGACTCCTCATCAACAGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005487.2-1616s1c1
Sequence:CCGGGCTCAGTATCTGCAGCACAAACTCGAGTTTGTGCTGCAGATACTGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005487.2-1799s1c1
Sequence:CCGGCCCATTGATGTTGCTGCTCATCTCGAGATGAGCAGCAACATCAATGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005487.2-1263s1c1
Sequence:CCGGCCAAGAGAAGTTTAGGACTTTCTCGAGAAAGTCCTAAACTTCTCTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005487.3-797s21c1
Sequence:CCGGTCGGGAGCCTGATGGTTTAAACTCGAGTTTAAACCATCAGGCTCCCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005487.3-1526s21c1
Sequence:CCGGTGACCATCCAGGTATAGATTTCTCGAGAAATCTATACCTGGATGGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005487.3-1095s21c1
Sequence:CCGGCTTTCAGGGCTTGAACCTATTCTCGAGAATAGGTTCAAGCCCTGAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005487.3-657s21c1
Sequence:CCGGTCAAGCCATTCGGAGAGTAAACTCGAGTTTACTCTCCGAATGGCTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178017
VALIDATED
HMGXB4 MISSION shRNA Bacterial Glycerol Stock
HMG box domain containing 4
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000081643    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178017.1-3020s1c1
Sequence:CCGGGCCCTCAATAATGTTAGGAAACTCGAGTTTCCTAACATTATTGAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178017.1-1869s1c1
Sequence:CCGGGCTGGACAACATTGCATACATCTCGAGATGTATGCAATGTTGTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178017.1-986s1c1
Sequence:CCGGCAATTCTAGTAGAGTCCGAATCTCGAGATTCGGACTCTACTAGAATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178017.1-985s1c1
Sequence:CCGGCCAATTCTAGTAGAGTCCGAACTCGAGTTCGGACTCTACTAGAATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178017.1-970s21c1
Sequence:CCGGATCACAGGGCTTGACCCAATTCTCGAGAATTGGGTCAAGCCCTGTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178017.1-1341s1c1
Sequence:CCGGCCAGGTATTCTGTAAGGAGTACTCGAGTACTCCTTACAGAATACCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178017.1-605s21c1
Sequence:CCGGATGACAGCAATGCCCACAAATCTCGAGATTTGTGGGCATTGCTGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178017.1-224s21c1
Sequence:CCGGGGTCTTACAAAGACTTCTTAACTCGAGTTAAGAAGTCTTTGTAAGACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178017.1-1869s21c1
Sequence:CCGGGCTGGACAACATTGCATACATCTCGAGATGTATGCAATGTTGTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178017.1-672s21c1
Sequence:CCGGTCGTGAGCCAGATGGCTTAAACTCGAGTTTAAGCCATCTGGCTCACGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178017.1-1380s21c1
Sequence:CCGGTGACCATCCAGGTATAGATTTCTCGAGAAATCTATACCTGGATGGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363965    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178017.1-2047s21c1
Sequence:CCGGACATAGGATATAACTACTTTGCTCGAGCAAAGTAGTTATATCCTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178017
VALIDATED
HMGXB4 MISSION shRNA shRNA Plasmid DNA
HMG box domain containing 4
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000081643    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178017.1-3020s1c1
Sequence:CCGGGCCCTCAATAATGTTAGGAAACTCGAGTTTCCTAACATTATTGAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178017.1-1869s1c1
Sequence:CCGGGCTGGACAACATTGCATACATCTCGAGATGTATGCAATGTTGTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178017.1-986s1c1
Sequence:CCGGCAATTCTAGTAGAGTCCGAATCTCGAGATTCGGACTCTACTAGAATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178017.1-985s1c1
Sequence:CCGGCCAATTCTAGTAGAGTCCGAACTCGAGTTCGGACTCTACTAGAATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178017.1-970s21c1
Sequence:CCGGATCACAGGGCTTGACCCAATTCTCGAGAATTGGGTCAAGCCCTGTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178017.1-1341s1c1
Sequence:CCGGCCAGGTATTCTGTAAGGAGTACTCGAGTACTCCTTACAGAATACCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178017.1-605s21c1
Sequence:CCGGATGACAGCAATGCCCACAAATCTCGAGATTTGTGGGCATTGCTGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178017.1-224s21c1
Sequence:CCGGGGTCTTACAAAGACTTCTTAACTCGAGTTAAGAAGTCTTTGTAAGACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178017.1-1869s21c1
Sequence:CCGGGCTGGACAACATTGCATACATCTCGAGATGTATGCAATGTTGTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178017.1-672s21c1
Sequence:CCGGTCGTGAGCCAGATGGCTTAAACTCGAGTTTAAGCCATCTGGCTCACGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178017.1-1380s21c1
Sequence:CCGGTGACCATCCAGGTATAGATTTCTCGAGAAATCTATACCTGGATGGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363965    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178017.1-2047s21c1
Sequence:CCGGACATAGGATATAACTACTTTGCTCGAGCAAAGTAGTTATATCCTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178017
VALIDATED
HMGXB4 MISSION shRNA Lentiviral Transduction Particles
HMG box domain containing 4
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000081643    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178017.1-3020s1c1
Sequence:CCGGGCCCTCAATAATGTTAGGAAACTCGAGTTTCCTAACATTATTGAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178017.1-1869s1c1
Sequence:CCGGGCTGGACAACATTGCATACATCTCGAGATGTATGCAATGTTGTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178017.1-986s1c1
Sequence:CCGGCAATTCTAGTAGAGTCCGAATCTCGAGATTCGGACTCTACTAGAATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178017.1-985s1c1
Sequence:CCGGCCAATTCTAGTAGAGTCCGAACTCGAGTTCGGACTCTACTAGAATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178017.1-970s21c1
Sequence:CCGGATCACAGGGCTTGACCCAATTCTCGAGAATTGGGTCAAGCCCTGTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178017.1-1341s1c1
Sequence:CCGGCCAGGTATTCTGTAAGGAGTACTCGAGTACTCCTTACAGAATACCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178017.1-605s21c1
Sequence:CCGGATGACAGCAATGCCCACAAATCTCGAGATTTGTGGGCATTGCTGTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178017.1-224s21c1
Sequence:CCGGGGTCTTACAAAGACTTCTTAACTCGAGTTAAGAAGTCTTTGTAAGACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178017.1-1869s21c1
Sequence:CCGGGCTGGACAACATTGCATACATCTCGAGATGTATGCAATGTTGTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178017.1-672s21c1
Sequence:CCGGTCGTGAGCCAGATGGCTTAAACTCGAGTTTAAGCCATCTGGCTCACGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178017.1-1380s21c1
Sequence:CCGGTGACCATCCAGGTATAGATTTCTCGAGAAATCTATACCTGGATGGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363965    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178017.1-2047s21c1
Sequence:CCGGACATAGGATATAACTACTTTGCTCGAGCAAAGTAGTTATATCCTATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)