EMAIL THIS PAGE TO A FRIEND

HMHA1

histocompatibility (minor) HA-1

43 Gene Product Result for
Synonyms: ARHGAP45 HA-1 HLA-HA1
Gene ID:
Mouse(70719) histocompatibility (minor) HA-1
Rat(314618) histocompatibility (minor) HA-1
Zebrafish(555849) histocompatibility (minor) HA-1
chicken(420102) histocompatibility (minor) HA-1
cow(512972) histocompatibility (minor) HA-1
dog(612358) histocompatibility (minor) HA-1
naked mole-rat(101709827) histocompatibility (minor) HA-1
sheep(101112901) histocompatibility (minor) HA-1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012292 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012292 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012292 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027521 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027521 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027521 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012292 Rosetta Predictions human pricing
NM_001108067 Rosetta Predictions rat pricing
NM_027521 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012292 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00108113 predicted 1087
2 SASI_Hs01_00108114 predicted 1744
3 SASI_Hs01_00108115 predicted 3523
4 SASI_Hs01_00108116 predicted 2332
5 SASI_Hs01_00108117 predicted 1962
6 SASI_Hs01_00108119 predicted 781
7 SASI_Hs01_00108120 predicted 958
8 SASI_Hs01_00108121 predicted 240
9 SASI_Hs01_00108122 predicted 1181
10 SASI_Hs02_00344040 predicted 2703
11 SASI_Hs01_00108118 predicted 1758
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108067 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00235024 predicted 1305
2 SASI_Rn02_00235025 predicted 1663
3 SASI_Rn02_00235026 predicted 2047
4 SASI_Rn02_00235027 predicted 1766
5 SASI_Rn02_00235028 predicted 3508
6 SASI_Rn02_00235029 predicted 1940
7 SASI_Rn02_00235030 predicted 1715
8 SASI_Rn02_00235031 predicted 577
9 SASI_Rn02_00235032 predicted 2530
10 SASI_Rn02_00235033 predicted 2572
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027521 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00043084 predicted 288
2 SASI_Mm01_00043085 predicted 630
3 SASI_Mm01_00043086 predicted 644
4 SASI_Mm01_00043087 predicted 2568
5 SASI_Mm01_00043088 predicted 1318
6 SASI_Mm01_00043089 predicted 2172
7 SASI_Mm01_00043090 predicted 2735
8 SASI_Mm01_00043091 predicted 1688
9 SASI_Mm01_00043092 predicted 1432
10 SASI_Mm01_00043093 predicted 2430
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012292
HMHA1 MISSION shRNA Bacterial Glycerol Stock
histocompatibility (minor) HA-1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000420062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012292.2-1755s21c1
Sequence:CCGGCTACTACCAGATGATGCATATCTCGAGATATGCATCATCTGGTAGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012292.2-1814s21c1
Sequence:CCGGGTGAGAGCAGCAAGCTGTATGCTCGAGCATACAGCTTGCTGCTCTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012292.2-2463s21c1
Sequence:CCGGCATACAGTGCGGGCACAAGAACTCGAGTTCTTGTGCCCGCACTGTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012292.2-1889s21c1
Sequence:CCGGCCGATGTGCACTACGACTTTGCTCGAGCAAAGTCGTAGTGCACATCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012292.1-799s1c1
Sequence:CCGGCTTCCATTATGAGAGCAACAACTCGAGTTGTTGCTCTCATAATGGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012292.1-3300s1c1
Sequence:CCGGCCCGAGTTGTGTCCAACGATTCTCGAGAATCGTTGGACACAACTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012292.1-2377s1c1
Sequence:CCGGCGAGTGCAACAGCTACGTCTACTCGAGTAGACGTAGCTGTTGCACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012292.1-2070s1c1
Sequence:CCGGGACACCAGGTTCACAAGTCATCTCGAGATGACTTGTGAACCTGGTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012292.1-1111s1c1
Sequence:CCGGCAAGTACATGAAGGACCTCATCTCGAGATGAGGTCCTTCATGTACTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012292
HMHA1 MISSION shRNA shRNA Plasmid DNA
histocompatibility (minor) HA-1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000420062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012292.2-1755s21c1
Sequence:CCGGCTACTACCAGATGATGCATATCTCGAGATATGCATCATCTGGTAGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012292.2-1814s21c1
Sequence:CCGGGTGAGAGCAGCAAGCTGTATGCTCGAGCATACAGCTTGCTGCTCTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012292.2-2463s21c1
Sequence:CCGGCATACAGTGCGGGCACAAGAACTCGAGTTCTTGTGCCCGCACTGTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012292.2-1889s21c1
Sequence:CCGGCCGATGTGCACTACGACTTTGCTCGAGCAAAGTCGTAGTGCACATCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012292.1-799s1c1
Sequence:CCGGCTTCCATTATGAGAGCAACAACTCGAGTTGTTGCTCTCATAATGGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012292.1-3300s1c1
Sequence:CCGGCCCGAGTTGTGTCCAACGATTCTCGAGAATCGTTGGACACAACTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012292.1-2377s1c1
Sequence:CCGGCGAGTGCAACAGCTACGTCTACTCGAGTAGACGTAGCTGTTGCACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012292.1-2070s1c1
Sequence:CCGGGACACCAGGTTCACAAGTCATCTCGAGATGACTTGTGAACCTGGTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012292.1-1111s1c1
Sequence:CCGGCAAGTACATGAAGGACCTCATCTCGAGATGAGGTCCTTCATGTACTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012292
HMHA1 MISSION shRNA Lentiviral Transduction Particles
histocompatibility (minor) HA-1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000420062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012292.2-1755s21c1
Sequence:CCGGCTACTACCAGATGATGCATATCTCGAGATATGCATCATCTGGTAGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012292.2-1814s21c1
Sequence:CCGGGTGAGAGCAGCAAGCTGTATGCTCGAGCATACAGCTTGCTGCTCTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012292.2-2463s21c1
Sequence:CCGGCATACAGTGCGGGCACAAGAACTCGAGTTCTTGTGCCCGCACTGTATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012292.2-1889s21c1
Sequence:CCGGCCGATGTGCACTACGACTTTGCTCGAGCAAAGTCGTAGTGCACATCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012292.1-799s1c1
Sequence:CCGGCTTCCATTATGAGAGCAACAACTCGAGTTGTTGCTCTCATAATGGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012292.1-3300s1c1
Sequence:CCGGCCCGAGTTGTGTCCAACGATTCTCGAGAATCGTTGGACACAACTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012292.1-2377s1c1
Sequence:CCGGCGAGTGCAACAGCTACGTCTACTCGAGTAGACGTAGCTGTTGCACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012292.1-2070s1c1
Sequence:CCGGGACACCAGGTTCACAAGTCATCTCGAGATGACTTGTGAACCTGGTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012292.1-1111s1c1
Sequence:CCGGCAAGTACATGAAGGACCTCATCTCGAGATGAGGTCCTTCATGTACTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027521
VALIDATED
HMHA1 MISSION shRNA Bacterial Glycerol Stock
histocompatibility (minor) HA-1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000306290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027521.3-1537s21c1
Sequence:CCGGCGAGGTCACCAGGTTCATAAGCTCGAGCTTATGAACCTGGTGACCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027521.3-1284s21c1
Sequence:CCGGGTGCGAGAGCAGCAAACTATACTCGAGTATAGTTTGCTGCTCTCGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326729    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027521.3-3133s21c1
Sequence:CCGGGCCGAGGAACTTCAGGGAGATCTCGAGATCTCCCTGAAGTTCCTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000354119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027521.3-2578s21c1
Sequence:CCGGCGAGTTATTGAGACTCTGATTCTCGAGAATCAGAGTCTCAATAACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027521.2-2578s1c1
Sequence:CCGGCGAGTTATTGAGACTCTGATTCTCGAGAATCAGAGTCTCAATAACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027521.3-257s21c1
Sequence:CCGGCCAAGGTCAAAGCCTTTCATTCTCGAGAATGAAAGGCTTTGACCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090708    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027521.2-3133s1c1
Sequence:CCGGGCCGAGGAACTTCAGGGAGATCTCGAGATCTCCCTGAAGTTCCTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027521.2-257s1c1
Sequence:CCGGCCAAGGTCAAAGCCTTTCATTCTCGAGAATGAAAGGCTTTGACCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027521.2-267s1c1
Sequence:CCGGAGCCTTTCATTATGAATGCAACTCGAGTTGCATTCATAATGAAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027521.2-2178s1c1
Sequence:CCGGCGACATCAGCAACGTCCTAAACTCGAGTTTAGGACGTTGCTGATGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027521
VALIDATED
HMHA1 MISSION shRNA shRNA Plasmid DNA
histocompatibility (minor) HA-1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000306290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027521.3-1537s21c1
Sequence:CCGGCGAGGTCACCAGGTTCATAAGCTCGAGCTTATGAACCTGGTGACCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027521.3-1284s21c1
Sequence:CCGGGTGCGAGAGCAGCAAACTATACTCGAGTATAGTTTGCTGCTCTCGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326729    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027521.3-3133s21c1
Sequence:CCGGGCCGAGGAACTTCAGGGAGATCTCGAGATCTCCCTGAAGTTCCTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000354119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027521.3-2578s21c1
Sequence:CCGGCGAGTTATTGAGACTCTGATTCTCGAGAATCAGAGTCTCAATAACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027521.2-2578s1c1
Sequence:CCGGCGAGTTATTGAGACTCTGATTCTCGAGAATCAGAGTCTCAATAACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027521.3-257s21c1
Sequence:CCGGCCAAGGTCAAAGCCTTTCATTCTCGAGAATGAAAGGCTTTGACCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090708    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027521.2-3133s1c1
Sequence:CCGGGCCGAGGAACTTCAGGGAGATCTCGAGATCTCCCTGAAGTTCCTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027521.2-257s1c1
Sequence:CCGGCCAAGGTCAAAGCCTTTCATTCTCGAGAATGAAAGGCTTTGACCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027521.2-267s1c1
Sequence:CCGGAGCCTTTCATTATGAATGCAACTCGAGTTGCATTCATAATGAAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027521.2-2178s1c1
Sequence:CCGGCGACATCAGCAACGTCCTAAACTCGAGTTTAGGACGTTGCTGATGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027521
VALIDATED
HMHA1 MISSION shRNA Lentiviral Transduction Particles
histocompatibility (minor) HA-1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000306290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027521.3-1537s21c1
Sequence:CCGGCGAGGTCACCAGGTTCATAAGCTCGAGCTTATGAACCTGGTGACCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027521.3-1284s21c1
Sequence:CCGGGTGCGAGAGCAGCAAACTATACTCGAGTATAGTTTGCTGCTCTCGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326729    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027521.3-3133s21c1
Sequence:CCGGGCCGAGGAACTTCAGGGAGATCTCGAGATCTCCCTGAAGTTCCTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000354119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027521.3-2578s21c1
Sequence:CCGGCGAGTTATTGAGACTCTGATTCTCGAGAATCAGAGTCTCAATAACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027521.2-2578s1c1
Sequence:CCGGCGAGTTATTGAGACTCTGATTCTCGAGAATCAGAGTCTCAATAACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027521.3-257s21c1
Sequence:CCGGCCAAGGTCAAAGCCTTTCATTCTCGAGAATGAAAGGCTTTGACCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090708    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027521.2-3133s1c1
Sequence:CCGGGCCGAGGAACTTCAGGGAGATCTCGAGATCTCCCTGAAGTTCCTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027521.2-257s1c1
Sequence:CCGGCCAAGGTCAAAGCCTTTCATTCTCGAGAATGAAAGGCTTTGACCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027521.2-267s1c1
Sequence:CCGGAGCCTTTCATTATGAATGCAACTCGAGTTGCATTCATAATGAAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027521.2-2178s1c1
Sequence:CCGGCGACATCAGCAACGTCCTAAACTCGAGTTTAGGACGTTGCTGATGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)