EMAIL THIS PAGE TO A FRIEND

HMMR

hyaluronan-mediated motility receptor (RHAMM)

97 Gene Product Result for
Synonyms: CD168 IHABP RHAMM
Gene ID:
Human(3161) Summary: The protein encoded by this gene is involved in cell motility. It is expressed in breast tissue and together with other proteins, it forms a complex with BRCA1 and BRCA2, thus is potentially associated with higher risk of breast cancer. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Dec 2008]
Mouse(15366) hyaluronan mediated motility receptor (RHAMM)
Rat(25460) hyaluronan mediated motility receptor (RHAMM)
Zebrafish(322012) hyaluronan-mediated motility receptor (RHAMM)
chicken(416163) hyaluronan-mediated motility receptor (RHAMM)
dog(611838) hyaluronan-mediated motility receptor (RHAMM)
cow(281227) hyaluronan-mediated motility receptor (RHAMM)
domestic cat(101087202) hyaluronan-mediated motility receptor (RHAMM)
domestic guinea pig(100734920) hyaluronan-mediated motility receptor (RHAMM)
naked mole-rat(101717355) hyaluronan-mediated motility receptor (RHAMM)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012484 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012484 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012484 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013552 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013552 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013552 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU060291 MISSION® esiRNA esiRNA human HMMR (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012484 Rosetta Predictions human pricing
NM_012485 Rosetta Predictions human pricing
NM_012964 Rosetta Predictions rat pricing
NM_013552 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012484 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00059526 predicted 1644
2 SASI_Hs01_00059527 predicted 854
3 SASI_Hs01_00059529 predicted 1379
4 SASI_Hs01_00059530 predicted 1398
5 SASI_Hs01_00059531 predicted 1179
6 SASI_Hs01_00059532 predicted 1536
7 SASI_Hs01_00059533 predicted 945
8 SASI_Hs01_00059534 predicted 734
9 SASI_Hs01_00059535 predicted 1145
10 SASI_Hs02_00344405 predicted 945
11 SASI_Hs01_00059528 predicted 1743
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012485 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00019342 predicted 1600
2 SASI_Hs01_00019343 predicted 811
3 SASI_Hs01_00019345 predicted 1336
4 SASI_Hs01_00019346 predicted 1356
5 SASI_Hs01_00019347 predicted 1138
6 SASI_Hs01_00019348 predicted 1498
7 SASI_Hs01_00019349 predicted 899
8 SASI_Hs01_00019350 predicted 689
9 SASI_Hs01_00019351 predicted 1099
10 SASI_Hs02_00344406 predicted 899
11 SASI_Hs01_00019344 predicted 1706
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012964 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00057206 predicted 791
2 SASI_Rn01_00057207 predicted 411
3 SASI_Rn02_00260565 predicted 1411
4 SASI_Rn01_00057208 predicted 1387
5 SASI_Rn01_00057209 predicted 1548
6 SASI_Rn01_00057210 predicted 513
7 SASI_Rn01_00057211 predicted 1712
8 SASI_Rn01_00057212 predicted 530
9 SASI_Rn01_00057213 predicted 224
10 SASI_Rn01_00057214 predicted 363
11 SASI_Rn01_00057205 predicted 1824
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013552 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00024512 predicted 2095
2 SASI_Mm01_00024513 predicted 1238
3 SASI_Mm01_00024515 predicted 607
4 SASI_Mm01_00024516 predicted 550
5 SASI_Mm01_00024517 predicted 451
6 SASI_Mm01_00024518 predicted 655
7 SASI_Mm01_00024519 predicted 1377
8 SASI_Mm02_00322281 predicted 1151
9 SASI_Mm01_00024520 predicted 873
10 SASI_Mm01_00024521 predicted 1943
11 SASI_Mm01_00024514 predicted 2058
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012484
VALIDATED
HMMR MISSION shRNA Bacterial Glycerol Stock
hyaluronan-mediated motility receptor (RHAMM)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012484.2-614s21c1
Sequence:CCGGCAGGACTAATGAACTACTAAACTCGAGTTTAGTAGTTCATTAGTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012484.2-1920s21c1
Sequence:CCGGCGTCTCCTCTATGAAGAACTACTCGAGTAGTTCTTCATAGAGGAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012484.2-2128s21c1
Sequence:CCGGGCCAACTCAAATCGGAAGTATCTCGAGATACTTCCGATTTGAGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012484.2-1727s21c1
Sequence:CCGGGCAGACCAAGTCAGCACTAAACTCGAGTTTAGTGCTGACTTGGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344923    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012484.2-2787s21c1
Sequence:CCGGTCACTTGGTCCTACCTATTATCTCGAGATAATAGGTAGGACCAAGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012484.1-467s1c1
Sequence:CCGGCCAGGACTAATGAACTACTAACTCGAGTTAGTAGTTCATTAGTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012484.1-251s1c1
Sequence:CCGGCGGAATCAAAGGAATCTCAAACTCGAGTTTGAGATTCCTTTGATTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012484.1-1774s1c1
Sequence:CCGGCGTCTCCTCTATGAAGAACTACTCGAGTAGTTCTTCATAGAGGAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012484.1-1982s1c1
Sequence:CCGGGCCAACTCAAATCGGAAGTATCTCGAGATACTTCCGATTTGAGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012484.1-1581s1c1
Sequence:CCGGGCAGACCAAGTCAGCACTAAACTCGAGTTTAGTGCTGACTTGGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012484
VALIDATED
HMMR MISSION shRNA shRNA Plasmid DNA
hyaluronan-mediated motility receptor (RHAMM)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012484.2-614s21c1
Sequence:CCGGCAGGACTAATGAACTACTAAACTCGAGTTTAGTAGTTCATTAGTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012484.2-1920s21c1
Sequence:CCGGCGTCTCCTCTATGAAGAACTACTCGAGTAGTTCTTCATAGAGGAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012484.2-2128s21c1
Sequence:CCGGGCCAACTCAAATCGGAAGTATCTCGAGATACTTCCGATTTGAGTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012484.2-1727s21c1
Sequence:CCGGGCAGACCAAGTCAGCACTAAACTCGAGTTTAGTGCTGACTTGGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344923    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012484.2-2787s21c1
Sequence:CCGGTCACTTGGTCCTACCTATTATCTCGAGATAATAGGTAGGACCAAGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012484.1-467s1c1
Sequence:CCGGCCAGGACTAATGAACTACTAACTCGAGTTAGTAGTTCATTAGTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012484.1-251s1c1
Sequence:CCGGCGGAATCAAAGGAATCTCAAACTCGAGTTTGAGATTCCTTTGATTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012484.1-1774s1c1
Sequence:CCGGCGTCTCCTCTATGAAGAACTACTCGAGTAGTTCTTCATAGAGGAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012484.1-1982s1c1
Sequence:CCGGGCCAACTCAAATCGGAAGTATCTCGAGATACTTCCGATTTGAGTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012484.1-1581s1c1
Sequence:CCGGGCAGACCAAGTCAGCACTAAACTCGAGTTTAGTGCTGACTTGGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012484
VALIDATED
HMMR MISSION shRNA Lentiviral Transduction Particles
hyaluronan-mediated motility receptor (RHAMM)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012484.2-614s21c1
Sequence:CCGGCAGGACTAATGAACTACTAAACTCGAGTTTAGTAGTTCATTAGTCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012484.2-1920s21c1
Sequence:CCGGCGTCTCCTCTATGAAGAACTACTCGAGTAGTTCTTCATAGAGGAGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012484.2-2128s21c1
Sequence:CCGGGCCAACTCAAATCGGAAGTATCTCGAGATACTTCCGATTTGAGTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012484.2-1727s21c1
Sequence:CCGGGCAGACCAAGTCAGCACTAAACTCGAGTTTAGTGCTGACTTGGTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344923    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012484.2-2787s21c1
Sequence:CCGGTCACTTGGTCCTACCTATTATCTCGAGATAATAGGTAGGACCAAGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012484.1-467s1c1
Sequence:CCGGCCAGGACTAATGAACTACTAACTCGAGTTAGTAGTTCATTAGTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012484.1-251s1c1
Sequence:CCGGCGGAATCAAAGGAATCTCAAACTCGAGTTTGAGATTCCTTTGATTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012484.1-1774s1c1
Sequence:CCGGCGTCTCCTCTATGAAGAACTACTCGAGTAGTTCTTCATAGAGGAGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012484.1-1982s1c1
Sequence:CCGGGCCAACTCAAATCGGAAGTATCTCGAGATACTTCCGATTTGAGTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012484.1-1581s1c1
Sequence:CCGGGCAGACCAAGTCAGCACTAAACTCGAGTTTAGTGCTGACTTGGTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013552
VALIDATED
HMMR MISSION shRNA Bacterial Glycerol Stock
hyaluronan-mediated motility receptor (RHAMM)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000311865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013552.2-307s21c1
Sequence:CCGGGACTCTCAGAAGAATGATAAACTCGAGTTTATCATTCTTCTGAGAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013552.2-2143s21c1
Sequence:CCGGCAGGCATTGTTGAATGAACATCTCGAGATGTTCATTCAACAATGCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013552.2-956s21c1
Sequence:CCGGGCCAGCTACTTGAAACAGAAACTCGAGTTTCTGTTTCAAGTAGCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013552.2-1712s21c1
Sequence:CCGGGCTATAAGTCATCAACACTTACTCGAGTAAGTGTTGATGACTTATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312846    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013552.2-2584s21c1
Sequence:CCGGACTGCCTAGTCTTAGGTATATCTCGAGATATACCTAAGACTAGGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013552.1-941s1c1
Sequence:CCGGGCCAGCTACTTGAAACAGAAACTCGAGTTTCTGTTTCAAGTAGCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013552.1-292s1c1
Sequence:CCGGGACTCTCAGAAGAATGATAAACTCGAGTTTATCATTCTTCTGAGAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013552.1-1697s1c1
Sequence:CCGGGCTATAAGTCATCAACACTTACTCGAGTAAGTGTTGATGACTTATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013552.1-507s1c1
Sequence:CCGGCGAGCTACTAAAGGCTAAGTTCTCGAGAACTTAGCCTTTAGTAGCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013552.1-2128s1c1
Sequence:CCGGCAGGCATTGTTGAATGAACATCTCGAGATGTTCATTCAACAATGCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013552
VALIDATED
HMMR MISSION shRNA shRNA Plasmid DNA
hyaluronan-mediated motility receptor (RHAMM)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000311865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013552.2-307s21c1
Sequence:CCGGGACTCTCAGAAGAATGATAAACTCGAGTTTATCATTCTTCTGAGAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013552.2-2143s21c1
Sequence:CCGGCAGGCATTGTTGAATGAACATCTCGAGATGTTCATTCAACAATGCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013552.2-956s21c1
Sequence:CCGGGCCAGCTACTTGAAACAGAAACTCGAGTTTCTGTTTCAAGTAGCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013552.2-1712s21c1
Sequence:CCGGGCTATAAGTCATCAACACTTACTCGAGTAAGTGTTGATGACTTATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312846    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013552.2-2584s21c1
Sequence:CCGGACTGCCTAGTCTTAGGTATATCTCGAGATATACCTAAGACTAGGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013552.1-941s1c1
Sequence:CCGGGCCAGCTACTTGAAACAGAAACTCGAGTTTCTGTTTCAAGTAGCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013552.1-292s1c1
Sequence:CCGGGACTCTCAGAAGAATGATAAACTCGAGTTTATCATTCTTCTGAGAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013552.1-1697s1c1
Sequence:CCGGGCTATAAGTCATCAACACTTACTCGAGTAAGTGTTGATGACTTATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013552.1-507s1c1
Sequence:CCGGCGAGCTACTAAAGGCTAAGTTCTCGAGAACTTAGCCTTTAGTAGCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013552.1-2128s1c1
Sequence:CCGGCAGGCATTGTTGAATGAACATCTCGAGATGTTCATTCAACAATGCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013552
VALIDATED
HMMR MISSION shRNA Lentiviral Transduction Particles
hyaluronan-mediated motility receptor (RHAMM)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000311865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013552.2-307s21c1
Sequence:CCGGGACTCTCAGAAGAATGATAAACTCGAGTTTATCATTCTTCTGAGAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013552.2-2143s21c1
Sequence:CCGGCAGGCATTGTTGAATGAACATCTCGAGATGTTCATTCAACAATGCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013552.2-956s21c1
Sequence:CCGGGCCAGCTACTTGAAACAGAAACTCGAGTTTCTGTTTCAAGTAGCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013552.2-1712s21c1
Sequence:CCGGGCTATAAGTCATCAACACTTACTCGAGTAAGTGTTGATGACTTATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312846    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013552.2-2584s21c1
Sequence:CCGGACTGCCTAGTCTTAGGTATATCTCGAGATATACCTAAGACTAGGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013552.1-941s1c1
Sequence:CCGGGCCAGCTACTTGAAACAGAAACTCGAGTTTCTGTTTCAAGTAGCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013552.1-292s1c1
Sequence:CCGGGACTCTCAGAAGAATGATAAACTCGAGTTTATCATTCTTCTGAGAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013552.1-1697s1c1
Sequence:CCGGGCTATAAGTCATCAACACTTACTCGAGTAAGTGTTGATGACTTATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013552.1-507s1c1
Sequence:CCGGCGAGCTACTAAAGGCTAAGTTCTCGAGAACTTAGCCTTTAGTAGCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013552.1-2128s1c1
Sequence:CCGGCAGGCATTGTTGAATGAACATCTCGAGATGTTCATTCAACAATGCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)