EMAIL THIS PAGE TO A FRIEND

HMOX1

heme oxygenase (decycling) 1

52 Gene Product Result for
Synonyms: HMOX1D HO-1 HSP32 bK286B10
UniProtKB ID: P09601
Gene ID:
Human(3162) Summary: Heme oxygenase, an essential enzyme in heme catabolism, cleaves heme to form biliverdin, which is subsequently converted to bilirubin by biliverdin reductase, and carbon monoxide, a putative neurotransmitter. Heme oxygenase activity is induced by its substrate heme and by various nonheme substances. Heme oxygenase occurs as 2 isozymes, an inducible heme oxygenase-1 and a constitutive heme oxygenase-2. HMOX1 and HMOX2 belong to the heme oxygenase family. [provided by RefSeq, Jul 2008]
Mouse(15368) heme oxygenase (decycling) 1
Rat(24451) heme oxygenase (decycling) 1
Zebrafish(791518) heme oxygenase (decycling) 1
cow(513221) heme oxygenase (decycling) 1
domestic cat(101092621) heme oxygenase (decycling) 1
dog(442987) heme oxygenase (decycling) 1
chicken(396287) heme oxygenase (decycling) 1
domestic guinea pig(100715748) heme oxygenase (decycling) 1
naked mole-rat(101708868) heme oxygenase (decycling) 1
Goat(100860951) heme oxygenase (decycling) 1
sheep(101120910) heme oxygenase (decycling) 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010442 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010442 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010442 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002133 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002133 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002133 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002133 Rosetta Predictions human pricing
NM_012580 Rosetta Predictions rat pricing
NM_010442 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002133 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00035065 predicted 1067
2 SASI_Hs01_00035067 predicted 616
3 SASI_Hs01_00035068 predicted 1259
4 SASI_Hs01_00035069 predicted 902
5 SASI_Hs01_00035070 predicted 688
6 SASI_Hs01_00035071 predicted 1135
7 SASI_Hs01_00035072 predicted 669
8 SASI_Hs01_00035074 predicted 903
9 SASI_Hs02_00333283 predicted 913
10 SASI_Hs02_00333284 predicted 988
11 SASI_Hs01_00035066 predicted 200
12 SASI_Hs01_00035073 predicted 412
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012580 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00086949 predicted 1316
2 SASI_Rn01_00086950 predicted 232
3 SASI_Rn01_00086951 predicted 1312
4 SASI_Rn01_00086952 predicted 1010
5 SASI_Rn01_00086954 predicted 788
6 SASI_Rn01_00086955 predicted 957
7 SASI_Rn01_00086956 predicted 424
8 SASI_Rn01_00086957 predicted 837
9 SASI_Rn02_00259714 predicted 774
10 SASI_Rn01_00086958 predicted 804
11 SASI_Rn01_00086953 predicted 720
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010442 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00159367 predicted 1041
2 SASI_Mm01_00159368 predicted 962
3 SASI_Mm02_00318602 predicted 951
4 SASI_Mm01_00159369 predicted 699
5 SASI_Mm01_00159371 predicted 685
6 SASI_Mm01_00159372 predicted 806
7 SASI_Mm01_00159373 predicted 1046
8 SASI_Mm01_00159374 predicted 331
9 SASI_Mm01_00159375 predicted 783
10 SASI_Mm01_00159376 predicted 426
11 SASI_Mm01_00159370 predicted 733
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010442
VALIDATED
HMOX1 MISSION shRNA Bacterial Glycerol Stock
heme oxygenase (decycling) 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000071582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010442.1-158s1c1
Sequence:CCGGCCAGGATTTGTCTGAGGCCTTCTCGAGAAGGCCTCAGACAAATCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010442.1-464s1c1
Sequence:CCGGGCACTATGTAAAGCGTCTCCACTCGAGTGGAGACGCTTTACATAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010442.1-977s1c1
Sequence:CCGGAGTGGGAATTTATGCCATGTACTCGAGTACATGGCATAAATTCCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010442.1-278s1c1
Sequence:CCGGGATGGCTTCCTTGTACCATATCTCGAGATATGGTACAAGGAAGCCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010442.1-665s1c1
Sequence:CCGGACAGCTCTATCGTGCTCGAATCTCGAGATTCGAGCACGATAGAGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010442.1-220s21c1
Sequence:GTACCGGCTGAGTTCATGAAGAACTTTCCTCGAGGAAAGTTCTTCATGAACTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218100    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010442.1-1362s21c1
Sequence:GTACCGGAGACATTTCTGTCTCGTATTTCTCGAGAAATACGAGACAGAAATGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010442.1-278s21c1
Sequence:CCGGGATGGCTTCCTTGTACCATATCTCGAGATATGGTACAAGGAAGCCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010442.1-455s21c1
Sequence:CCGGAGCCACACAGCACTATGTAAACTCGAGTTTACATAGTGCTGTGTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010442.1-969s21c1
Sequence:CCGGACAGTGGCAGTGGGAATTTATCTCGAGATAAATTCCCACTGCCACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010442
VALIDATED
HMOX1 MISSION shRNA shRNA Plasmid DNA
heme oxygenase (decycling) 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000071582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010442.1-158s1c1
Sequence:CCGGCCAGGATTTGTCTGAGGCCTTCTCGAGAAGGCCTCAGACAAATCCTGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000071579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010442.1-464s1c1
Sequence:CCGGGCACTATGTAAAGCGTCTCCACTCGAGTGGAGACGCTTTACATAGTGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000071580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010442.1-977s1c1
Sequence:CCGGAGTGGGAATTTATGCCATGTACTCGAGTACATGGCATAAATTCCCACTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000071578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010442.1-278s1c1
Sequence:CCGGGATGGCTTCCTTGTACCATATCTCGAGATATGGTACAAGGAAGCCATCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000071581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010442.1-665s1c1
Sequence:CCGGACAGCTCTATCGTGCTCGAATCTCGAGATTCGAGCACGATAGAGCTGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000218054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010442.1-220s21c1
Sequence:GTACCGGCTGAGTTCATGAAGAACTTTCCTCGAGGAAAGTTCTTCATGAACTCAGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000218100    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010442.1-1362s21c1
Sequence:GTACCGGAGACATTTCTGTCTCGTATTTCTCGAGAAATACGAGACAGAAATGTCTTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000234075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010442.1-278s21c1
Sequence:CCGGGATGGCTTCCTTGTACCATATCTCGAGATATGGTACAAGGAAGCCATCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000234076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010442.1-455s21c1
Sequence:CCGGAGCCACACAGCACTATGTAAACTCGAGTTTACATAGTGCTGTGTGGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000234077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010442.1-969s21c1
Sequence:CCGGACAGTGGCAGTGGGAATTTATCTCGAGATAAATTCCCACTGCCACTGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010442
VALIDATED
HMOX1 MISSION shRNA Lentiviral Transduction Particles
heme oxygenase (decycling) 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000071582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010442.1-158s1c1
Sequence:CCGGCCAGGATTTGTCTGAGGCCTTCTCGAGAAGGCCTCAGACAAATCCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010442.1-464s1c1
Sequence:CCGGGCACTATGTAAAGCGTCTCCACTCGAGTGGAGACGCTTTACATAGTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010442.1-977s1c1
Sequence:CCGGAGTGGGAATTTATGCCATGTACTCGAGTACATGGCATAAATTCCCACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010442.1-278s1c1
Sequence:CCGGGATGGCTTCCTTGTACCATATCTCGAGATATGGTACAAGGAAGCCATCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010442.1-665s1c1
Sequence:CCGGACAGCTCTATCGTGCTCGAATCTCGAGATTCGAGCACGATAGAGCTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010442.1-220s21c1
Sequence:GTACCGGCTGAGTTCATGAAGAACTTTCCTCGAGGAAAGTTCTTCATGAACTCAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218100    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010442.1-1362s21c1
Sequence:GTACCGGAGACATTTCTGTCTCGTATTTCTCGAGAAATACGAGACAGAAATGTCTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010442.1-278s21c1
Sequence:CCGGGATGGCTTCCTTGTACCATATCTCGAGATATGGTACAAGGAAGCCATCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010442.1-455s21c1
Sequence:CCGGAGCCACACAGCACTATGTAAACTCGAGTTTACATAGTGCTGTGTGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010442.1-969s21c1
Sequence:CCGGACAGTGGCAGTGGGAATTTATCTCGAGATAAATTCCCACTGCCACTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002133
VALIDATED
HMOX1 MISSION shRNA Bacterial Glycerol Stock
heme oxygenase (decycling) 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000296640    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002133.1-1137s21c1
Sequence:CCGGCATCCAGGCAATGGCCTAAACCTCGAGGTTTAGGCCATTGCCTGGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002133.1-281s1c1
Sequence:CCGGCAACAAGGAGAGCCCAGTCTTCTCGAGAAGACTGGGCTCTCCTTGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002133.1-171s1c1
Sequence:CCGGGCTGAGTTCATGAGGAACTTTCTCGAGAAAGTTCCTCATGAACTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002133.1-795s1c1
Sequence:CCGGCGGGCCAGCAACAAAGTGCAACTCGAGTTGCACTTTGTTGCTGGCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002133.1-918s1c1
Sequence:CCGGACAGTTGCTGTAGGGCTTTATCTCGAGATAAAGCCCTACAGCAACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002133.1-888s1c1
Sequence:CCGGTGGGTCCTTACACTCAGCTTTCTCGAGAAAGCTGAGTGTAAGGACCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002133.1-235s21c1
Sequence:CCGGCCTCCCTGTACCACATCTATGCTCGAGCATAGATGTGGTACAGGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_002133.1-918s21c1
Sequence:CCGGACAGTTGCTGTAGGGCTTTATCTCGAGATAAAGCCCTACAGCAACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_002133.1-171s21c1
Sequence:CCGGGCTGAGTTCATGAGGAACTTTCTCGAGAAAGTTCCTCATGAACTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002133.1-888s21c1
Sequence:CCGGTGGGTCCTTACACTCAGCTTTCTCGAGAAAGCTGAGTGTAAGGACCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002133
VALIDATED
HMOX1 MISSION shRNA shRNA Plasmid DNA
heme oxygenase (decycling) 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000296640    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002133.1-1137s21c1
Sequence:CCGGCATCCAGGCAATGGCCTAAACCTCGAGGTTTAGGCCATTGCCTGGATGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000045251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002133.1-281s1c1
Sequence:CCGGCAACAAGGAGAGCCCAGTCTTCTCGAGAAGACTGGGCTCTCCTTGTTGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000045248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002133.1-171s1c1
Sequence:CCGGGCTGAGTTCATGAGGAACTTTCTCGAGAAAGTTCCTCATGAACTCAGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000045249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002133.1-795s1c1
Sequence:CCGGCGGGCCAGCAACAAAGTGCAACTCGAGTTGCACTTTGTTGCTGGCCCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000045250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002133.1-918s1c1
Sequence:CCGGACAGTTGCTGTAGGGCTTTATCTCGAGATAAAGCCCTACAGCAACTGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000045252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002133.1-888s1c1
Sequence:CCGGTGGGTCCTTACACTCAGCTTTCTCGAGAAAGCTGAGTGTAAGGACCCATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000296718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002133.1-235s21c1
Sequence:CCGGCCTCCCTGTACCACATCTATGCTCGAGCATAGATGTGGTACAGGGAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000290435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_002133.1-918s21c1
Sequence:CCGGACAGTTGCTGTAGGGCTTTATCTCGAGATAAAGCCCTACAGCAACTGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000290436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_002133.1-171s21c1
Sequence:CCGGGCTGAGTTCATGAGGAACTTTCTCGAGAAAGTTCCTCATGAACTCAGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000290505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002133.1-888s21c1
Sequence:CCGGTGGGTCCTTACACTCAGCTTTCTCGAGAAAGCTGAGTGTAAGGACCCATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002133
VALIDATED
HMOX1 MISSION shRNA Lentiviral Transduction Particles
heme oxygenase (decycling) 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000296640    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002133.1-1137s21c1
Sequence:CCGGCATCCAGGCAATGGCCTAAACCTCGAGGTTTAGGCCATTGCCTGGATGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002133.1-281s1c1
Sequence:CCGGCAACAAGGAGAGCCCAGTCTTCTCGAGAAGACTGGGCTCTCCTTGTTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002133.1-171s1c1
Sequence:CCGGGCTGAGTTCATGAGGAACTTTCTCGAGAAAGTTCCTCATGAACTCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002133.1-795s1c1
Sequence:CCGGCGGGCCAGCAACAAAGTGCAACTCGAGTTGCACTTTGTTGCTGGCCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002133.1-918s1c1
Sequence:CCGGACAGTTGCTGTAGGGCTTTATCTCGAGATAAAGCCCTACAGCAACTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002133.1-888s1c1
Sequence:CCGGTGGGTCCTTACACTCAGCTTTCTCGAGAAAGCTGAGTGTAAGGACCCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002133.1-235s21c1
Sequence:CCGGCCTCCCTGTACCACATCTATGCTCGAGCATAGATGTGGTACAGGGAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_002133.1-918s21c1
Sequence:CCGGACAGTTGCTGTAGGGCTTTATCTCGAGATAAAGCCCTACAGCAACTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_002133.1-171s21c1
Sequence:CCGGGCTGAGTTCATGAGGAACTTTCTCGAGAAAGTTCCTCATGAACTCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002133.1-888s21c1
Sequence:CCGGTGGGTCCTTACACTCAGCTTTCTCGAGAAAGCTGAGTGTAAGGACCCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)