EMAIL THIS PAGE TO A FRIEND

HMOX2

heme oxygenase (decycling) 2

99 Gene Product Result for
Synonyms: HO-2
UniProtKB ID: P30519, A8MT35, D3DUD5, O60605
Gene ID:
Human(3163) Summary: Heme oxygenase, an essential enzyme in heme catabolism, cleaves heme to form biliverdin, which is subsequently converted to bilirubin by biliverdin reductase, and carbon monoxide, a putative neurotransmitter. Heme oxygenase activity is induced by its substrate heme and by various nonheme substances. Heme oxygenase occurs as 2 isozymes, an inducible heme oxygenase-1 and a constitutive heme oxygenase-2. HMOX1 and HMOX2 belong to the heme oxygenase family. Alternative splice variants encoding the same protein have been identified at this locus. [provided by RefSeq, Jul 2008]
Mouse(15369) heme oxygenase (decycling) 2
Rat(79239) heme oxygenase (decycling) 2
sheep(101102279) heme oxygenase (decycling) 2
Domestic Rabbit(100009523) heme oxygenase (decycling) 2
domestic guinea pig(100719916) heme oxygenase (decycling) 2
naked mole-rat(101718879) heme oxygenase (decycling) 2
chicken(416663) heme oxygenase (decycling) 2
cow(510243) heme oxygenase (decycling) 2
domestic cat(101093823) heme oxygenase (decycling) 2
dog(479864) heme oxygenase (decycling) 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010443 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010443 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010443 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002134 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002134 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002134 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001127204 Rosetta Predictions human pricing
NM_001127205 Rosetta Predictions human pricing
NM_001127206 Rosetta Predictions human pricing
NM_002134 Rosetta Predictions human pricing
NM_024387 Rosetta Predictions rat pricing
NM_010443 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127204 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00328732 predicted 1100
2 SASI_Hs02_00328733 predicted 1361
3 SASI_Hs02_00328734 predicted 623
4 SASI_Hs02_00328735 predicted 848
5 SASI_Hs02_00328736 predicted 1070
6 SASI_Hs02_00328737 predicted 1062
7 SASI_Hs02_00328738 predicted 1411
8 SASI_Hs02_00328739 predicted 710
9 SASI_Hs02_00328740 predicted 1158
10 SASI_Hs02_00328741 predicted 633
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127205 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00328742 predicted 1004
2 SASI_Hs02_00328743 predicted 1262
3 SASI_Hs02_00328744 predicted 526
4 SASI_Hs02_00328745 predicted 756
5 SASI_Hs02_00328746 predicted 983
6 SASI_Hs02_00328747 predicted 968
7 SASI_Hs02_00328748 predicted 1315
8 SASI_Hs02_00328749 predicted 619
9 SASI_Hs02_00328750 predicted 1070
10 SASI_Hs02_00328751 predicted 541
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127206 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00328752 predicted 960
2 SASI_Hs02_00328753 predicted 1223
3 SASI_Hs02_00328754 predicted 494
4 SASI_Hs02_00328755 predicted 719
5 SASI_Hs02_00328756 predicted 939
6 SASI_Hs02_00328757 predicted 922
7 SASI_Hs02_00328758 predicted 1276
8 SASI_Hs02_00328759 predicted 571
9 SASI_Hs02_00328760 predicted 1028
10 SASI_Hs02_00328761 predicted 498
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002134 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00333285 predicted 978
2 SASI_Hs01_00035225 predicted 1240
3 SASI_Hs01_00035226 predicted 508
4 SASI_Hs01_00035227 predicted 736
5 SASI_Hs01_00035229 predicted 958
6 SASI_Hs02_00333286 predicted 946
7 SASI_Hs02_00333287 predicted 1288
8 SASI_Hs01_00035230 predicted 597
9 SASI_Hs02_00333288 predicted 1047
10 SASI_Hs01_00035231 predicted 521
11 SASI_Hs01_00035228 predicted 1171
12 SASI_Hs01_00035232 predicted 264
13 SASI_Hs01_00035233 predicted 296
14 SASI_Hs01_00035234 predicted 762
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024387 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00103240 predicted 1095
2 SASI_Rn01_00103241 predicted 786
3 SASI_Rn01_00103242 predicted 1250
4 SASI_Rn01_00103243 predicted 1391
5 SASI_Rn01_00103244 predicted 1418
6 SASI_Rn01_00103245 predicted 1366
7 SASI_Rn01_00103246 predicted 764
8 SASI_Rn01_00103247 predicted 220
9 SASI_Rn01_00103248 predicted 561
10 SASI_Rn01_00103249 predicted 947
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010443 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00318603 predicted 638
2 SASI_Mm01_00033544 predicted 570
3 SASI_Mm01_00033545 predicted 493
4 SASI_Mm01_00033546 predicted 485
5 SASI_Mm01_00033547 predicted 812
6 SASI_Mm01_00033548 predicted 758
7 SASI_Mm01_00033549 predicted 338
8 SASI_Mm01_00033550 predicted 833
9 SASI_Mm01_00033551 predicted 206
10 SASI_Mm02_00318604 predicted 916
11 SASI_Mm01_00033552 predicted 773
12 SASI_Mm01_00033553 predicted 557
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010443
VALIDATED
HMOX2 MISSION shRNA Bacterial Glycerol Stock
heme oxygenase (decycling) 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000324041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010443.2-339s21c1
Sequence:CCGGGAAACATTAAGAAGGAGCTATCTCGAGATAGCTCCTTCTTAATGTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010443.2-745s21c1
Sequence:CCGGCCAGCAATTCAAGCAGTTCTACTCGAGTAGAACTGCTTGAATTGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010443.2-372s21c1
Sequence:CCGGCCACTGCACTTTACTTCACATCTCGAGATGTGAAGTAAAGTGCAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010443.1-746s1c2
Sequence:CCGGCCAGCAATTCAAGCAGTTCTACTCGAGTAGAACTGCTTGAATTGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010443.2-612s21c1
Sequence:CCGGCCCATGCTTATACTCGTTACACTCGAGTGTAACGAGTATAAGCATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010443.1-373s1c1
Sequence:CCGGCCACTGCACTTTACTTCACATCTCGAGATGTGAAGTAAAGTGCAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010443.1-340s1c1
Sequence:CCGGGAAACATTAAGAAGGAGCTATCTCGAGATAGCTCCTTCTTAATGTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010443.1-613s1c1
Sequence:CCGGCCCATGCTTATACTCGTTACACTCGAGTGTAACGAGTATAAGCATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010443.1-614s1c1
Sequence:CCGGCCATGCTTATACTCGTTACATCTCGAGATGTAACGAGTATAAGCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010443
VALIDATED
HMOX2 MISSION shRNA shRNA Plasmid DNA
heme oxygenase (decycling) 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000324041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010443.2-339s21c1
Sequence:CCGGGAAACATTAAGAAGGAGCTATCTCGAGATAGCTCCTTCTTAATGTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010443.2-745s21c1
Sequence:CCGGCCAGCAATTCAAGCAGTTCTACTCGAGTAGAACTGCTTGAATTGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010443.2-372s21c1
Sequence:CCGGCCACTGCACTTTACTTCACATCTCGAGATGTGAAGTAAAGTGCAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000222630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010443.1-746s1c2
Sequence:CCGGCCAGCAATTCAAGCAGTTCTACTCGAGTAGAACTGCTTGAATTGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010443.2-612s21c1
Sequence:CCGGCCCATGCTTATACTCGTTACACTCGAGTGTAACGAGTATAAGCATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010443.1-373s1c1
Sequence:CCGGCCACTGCACTTTACTTCACATCTCGAGATGTGAAGTAAAGTGCAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010443.1-340s1c1
Sequence:CCGGGAAACATTAAGAAGGAGCTATCTCGAGATAGCTCCTTCTTAATGTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010443.1-613s1c1
Sequence:CCGGCCCATGCTTATACTCGTTACACTCGAGTGTAACGAGTATAAGCATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010443.1-614s1c1
Sequence:CCGGCCATGCTTATACTCGTTACATCTCGAGATGTAACGAGTATAAGCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010443
VALIDATED
HMOX2 MISSION shRNA Lentiviral Transduction Particles
heme oxygenase (decycling) 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000324041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010443.2-339s21c1
Sequence:CCGGGAAACATTAAGAAGGAGCTATCTCGAGATAGCTCCTTCTTAATGTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010443.2-745s21c1
Sequence:CCGGCCAGCAATTCAAGCAGTTCTACTCGAGTAGAACTGCTTGAATTGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010443.2-372s21c1
Sequence:CCGGCCACTGCACTTTACTTCACATCTCGAGATGTGAAGTAAAGTGCAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010443.1-746s1c2
Sequence:CCGGCCAGCAATTCAAGCAGTTCTACTCGAGTAGAACTGCTTGAATTGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010443.2-612s21c1
Sequence:CCGGCCCATGCTTATACTCGTTACACTCGAGTGTAACGAGTATAAGCATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010443.1-373s1c1
Sequence:CCGGCCACTGCACTTTACTTCACATCTCGAGATGTGAAGTAAAGTGCAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010443.1-340s1c1
Sequence:CCGGGAAACATTAAGAAGGAGCTATCTCGAGATAGCTCCTTCTTAATGTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010443.1-613s1c1
Sequence:CCGGCCCATGCTTATACTCGTTACACTCGAGTGTAACGAGTATAAGCATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010443.1-614s1c1
Sequence:CCGGCCATGCTTATACTCGTTACATCTCGAGATGTAACGAGTATAAGCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002134
VALIDATED
HMOX2 MISSION shRNA Bacterial Glycerol Stock
heme oxygenase (decycling) 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000290514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002134.3-342s21c1
Sequence:CCGGCCAGTTTGTCAAGGACTTCTTCTCGAGAAGAAGTCCTTGACAAACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002134.3-600s21c1
Sequence:CCGGGATCCACTACATAGGGCAGAACTCGAGTTCTGCCCTATGTAGTGGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002134.3-742s21c1
Sequence:CCGGCAGTTCTACCTGTTTGAGAATCTCGAGATTCTCAAACAGGTAGAACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002134.3-401s21c1
Sequence:CCGGCCACGGCACTTTACTTCACATCTCGAGATGTGAAGTAAAGTGCCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_002134.2-296s1c1
Sequence:CCGGCCACGGCACTTTACTTCACATCTCGAGATGTGAAGTAAAGTGCCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_002134.2-495s1c1
Sequence:CCGGGATCCACTACATAGGGCAGAACTCGAGTTCTGCCCTATGTAGTGGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_002134.2-637s1c1
Sequence:CCGGCAGTTCTACCTGTTTGAGAATCTCGAGATTCTCAAACAGGTAGAACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_002134.2-867s1c1
Sequence:CCGGCATGCGTAAATGCCCTTTCTACTCGAGTAGAAAGGGCATTTACGCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_002134.2-237s1c1
Sequence:CCGGCCAGTTTGTCAAGGACTTCTTCTCGAGAAGAAGTCCTTGACAAACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002134
VALIDATED
HMOX2 MISSION shRNA shRNA Plasmid DNA
heme oxygenase (decycling) 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000290514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002134.3-342s21c1
Sequence:CCGGCCAGTTTGTCAAGGACTTCTTCTCGAGAAGAAGTCCTTGACAAACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002134.3-600s21c1
Sequence:CCGGGATCCACTACATAGGGCAGAACTCGAGTTCTGCCCTATGTAGTGGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002134.3-742s21c1
Sequence:CCGGCAGTTCTACCTGTTTGAGAATCTCGAGATTCTCAAACAGGTAGAACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002134.3-401s21c1
Sequence:CCGGCCACGGCACTTTACTTCACATCTCGAGATGTGAAGTAAAGTGCCGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_002134.2-296s1c1
Sequence:CCGGCCACGGCACTTTACTTCACATCTCGAGATGTGAAGTAAAGTGCCGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_002134.2-495s1c1
Sequence:CCGGGATCCACTACATAGGGCAGAACTCGAGTTCTGCCCTATGTAGTGGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_002134.2-637s1c1
Sequence:CCGGCAGTTCTACCTGTTTGAGAATCTCGAGATTCTCAAACAGGTAGAACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_002134.2-867s1c1
Sequence:CCGGCATGCGTAAATGCCCTTTCTACTCGAGTAGAAAGGGCATTTACGCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_002134.2-237s1c1
Sequence:CCGGCCAGTTTGTCAAGGACTTCTTCTCGAGAAGAAGTCCTTGACAAACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002134
VALIDATED
HMOX2 MISSION shRNA Lentiviral Transduction Particles
heme oxygenase (decycling) 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000290514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002134.3-342s21c1
Sequence:CCGGCCAGTTTGTCAAGGACTTCTTCTCGAGAAGAAGTCCTTGACAAACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002134.3-600s21c1
Sequence:CCGGGATCCACTACATAGGGCAGAACTCGAGTTCTGCCCTATGTAGTGGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002134.3-742s21c1
Sequence:CCGGCAGTTCTACCTGTTTGAGAATCTCGAGATTCTCAAACAGGTAGAACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002134.3-401s21c1
Sequence:CCGGCCACGGCACTTTACTTCACATCTCGAGATGTGAAGTAAAGTGCCGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_002134.2-296s1c1
Sequence:CCGGCCACGGCACTTTACTTCACATCTCGAGATGTGAAGTAAAGTGCCGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_002134.2-495s1c1
Sequence:CCGGGATCCACTACATAGGGCAGAACTCGAGTTCTGCCCTATGTAGTGGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_002134.2-637s1c1
Sequence:CCGGCAGTTCTACCTGTTTGAGAATCTCGAGATTCTCAAACAGGTAGAACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_002134.2-867s1c1
Sequence:CCGGCATGCGTAAATGCCCTTTCTACTCGAGTAGAAAGGGCATTTACGCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_002134.2-237s1c1
Sequence:CCGGCCAGTTTGTCAAGGACTTCTTCTCGAGAAGAAGTCCTTGACAAACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)