EMAIL THIS PAGE TO A FRIEND

HMP19

93 Gene Product Result for
Gene ID:
Zebrafish(324971) HMP19 protein
cow(613901) HMP19 protein
dog(612882) HMP19 protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015980 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015980 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015980 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU035361 MISSION® esiRNA esiRNA human AC093310.1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015980 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015980 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00022252 predicted 447
2 SASI_Hs01_00022254 predicted 318
3 SASI_Hs02_00348652 predicted 233
4 SASI_Hs01_00022256 predicted 1135
5 SASI_Hs01_00022257 predicted 1120
6 SASI_Hs01_00022258 predicted 1033
7 SASI_Hs01_00022259 predicted 323
8 SASI_Hs01_00022261 predicted 292
9 SASI_Hs02_00348653 predicted 347
10 SASI_Hs02_00348654 predicted 288
11 SASI_Hs01_00022253 predicted 231
12 SASI_Hs01_00022255 predicted 1060
13 SASI_Hs01_00022260 predicted 1058
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015980
HMP19 MISSION shRNA Bacterial Glycerol Stock
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000153463    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015980.3-2186s1c1
Sequence:CCGGCGGAATAACAAGTTGTCCCTACTCGAGTAGGGACAACTTGTTATTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015980.3-281s1c1
Sequence:CCGGGTGAAGACAAGAACGGAATATCTCGAGATATTCCGTTCTTGTCTTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151162    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015980.3-941s1c1
Sequence:CCGGGCCACTGCTTATTCTTTGTTACTCGAGTAACAAAGAATAAGCAGTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151229    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015980.3-416s1c1
Sequence:CCGGGTTTACAAAGCCTTCACCTATCTCGAGATAGGTGAAGGCTTTGTAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153279    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015980.3-2063s1c1
Sequence:CCGGGCTGGGTAATAAGACTAGCATCTCGAGATGCTAGTCTTATTACCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158344    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015980.3-306s1c1
Sequence:CCGGCGGAACAGAAGAACAAAGGGACTCGAGTCCCTTTGTTCTTCTGTTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015980.3-346s1c1
Sequence:CCGGCGCTGAATTTACGGTCACCATCTCGAGATGGTGACCGTAAATTCAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158192    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015980.3-400s1c1
Sequence:CCGGCATCGTGTTCCTGGTGGTTTACTCGAGTAAACCACCAGGAACACGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434817    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015980.3-915s21c1
Sequence:CCGGTTGTTCCCATGTAAGATATTTCTCGAGAAATATCTTACATGGGAACAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418744    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015980.3-824s21c1
Sequence:CCGGGAGTTGTCTGAACCGATATTTCTCGAGAAATATCGGTTCAGACAACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015980.3-227s21c1
Sequence:CCGGATCACTCCCTTGGAGGTTAATCTCGAGATTAACCTCCAAGGGAGTGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432896    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015980.3-1133s21c1
Sequence:CCGGAGACCGGGACTATTCCATTAGCTCGAGCTAATGGAATAGTCCCGGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015980.3-447s21c1
Sequence:CCGGGCCCAGAGGGATTCGTCTATACTCGAGTATAGACGAATCCCTCTGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015980
HMP19 MISSION shRNA shRNA Plasmid DNA
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000153463    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015980.3-2186s1c1
Sequence:CCGGCGGAATAACAAGTTGTCCCTACTCGAGTAGGGACAACTTGTTATTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015980.3-281s1c1
Sequence:CCGGGTGAAGACAAGAACGGAATATCTCGAGATATTCCGTTCTTGTCTTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151162    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015980.3-941s1c1
Sequence:CCGGGCCACTGCTTATTCTTTGTTACTCGAGTAACAAAGAATAAGCAGTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151229    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015980.3-416s1c1
Sequence:CCGGGTTTACAAAGCCTTCACCTATCTCGAGATAGGTGAAGGCTTTGTAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153279    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015980.3-2063s1c1
Sequence:CCGGGCTGGGTAATAAGACTAGCATCTCGAGATGCTAGTCTTATTACCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158344    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015980.3-306s1c1
Sequence:CCGGCGGAACAGAAGAACAAAGGGACTCGAGTCCCTTTGTTCTTCTGTTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015980.3-346s1c1
Sequence:CCGGCGCTGAATTTACGGTCACCATCTCGAGATGGTGACCGTAAATTCAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158192    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015980.3-400s1c1
Sequence:CCGGCATCGTGTTCCTGGTGGTTTACTCGAGTAAACCACCAGGAACACGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434817    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015980.3-915s21c1
Sequence:CCGGTTGTTCCCATGTAAGATATTTCTCGAGAAATATCTTACATGGGAACAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418744    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015980.3-824s21c1
Sequence:CCGGGAGTTGTCTGAACCGATATTTCTCGAGAAATATCGGTTCAGACAACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015980.3-227s21c1
Sequence:CCGGATCACTCCCTTGGAGGTTAATCTCGAGATTAACCTCCAAGGGAGTGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432896    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015980.3-1133s21c1
Sequence:CCGGAGACCGGGACTATTCCATTAGCTCGAGCTAATGGAATAGTCCCGGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015980.3-447s21c1
Sequence:CCGGGCCCAGAGGGATTCGTCTATACTCGAGTATAGACGAATCCCTCTGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015980
HMP19 MISSION shRNA Lentiviral Transduction Particles
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000153463    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015980.3-2186s1c1
Sequence:CCGGCGGAATAACAAGTTGTCCCTACTCGAGTAGGGACAACTTGTTATTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015980.3-281s1c1
Sequence:CCGGGTGAAGACAAGAACGGAATATCTCGAGATATTCCGTTCTTGTCTTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151162    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015980.3-941s1c1
Sequence:CCGGGCCACTGCTTATTCTTTGTTACTCGAGTAACAAAGAATAAGCAGTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151229    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015980.3-416s1c1
Sequence:CCGGGTTTACAAAGCCTTCACCTATCTCGAGATAGGTGAAGGCTTTGTAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153279    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015980.3-2063s1c1
Sequence:CCGGGCTGGGTAATAAGACTAGCATCTCGAGATGCTAGTCTTATTACCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158344    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015980.3-306s1c1
Sequence:CCGGCGGAACAGAAGAACAAAGGGACTCGAGTCCCTTTGTTCTTCTGTTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015980.3-346s1c1
Sequence:CCGGCGCTGAATTTACGGTCACCATCTCGAGATGGTGACCGTAAATTCAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158192    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015980.3-400s1c1
Sequence:CCGGCATCGTGTTCCTGGTGGTTTACTCGAGTAAACCACCAGGAACACGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434817    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015980.3-915s21c1
Sequence:CCGGTTGTTCCCATGTAAGATATTTCTCGAGAAATATCTTACATGGGAACAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418744    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015980.3-824s21c1
Sequence:CCGGGAGTTGTCTGAACCGATATTTCTCGAGAAATATCGGTTCAGACAACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015980.3-227s21c1
Sequence:CCGGATCACTCCCTTGGAGGTTAATCTCGAGATTAACCTCCAAGGGAGTGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432896    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015980.3-1133s21c1
Sequence:CCGGAGACCGGGACTATTCCATTAGCTCGAGCTAATGGAATAGTCCCGGTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015980.3-447s21c1
Sequence:CCGGGCCCAGAGGGATTCGTCTATACTCGAGTATAGACGAATCCCTCTGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)