EMAIL THIS PAGE TO A FRIEND

HMSD

histocompatibility (minor) serpin domain containing

23 Gene Product Result for
Synonyms: ACC-6 C18orf53 HSMD-v
Species: Human HMSD(284293)
UniProtKB ID: P0C7T4
Gene ID:
Human(284293) Summary: This gene encodes a serpin-domain containing protein that may function as a serine protease inhibitor. This gene is primarily expressed in cells of myeloid lineage. A polymorphism in this gene may result in the expression a splice variant that encodes a minor histocompatibility antigen. [provided by RefSeq, Oct 2010]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001123366 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001123366 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001123366 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_209104 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_209104 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_209104 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001123366 Rosetta Predictions human pricing
XM_209104 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001123366 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00327814 predicted 276
2 SASI_Hs02_00327815 predicted 375
3 SASI_Hs02_00327816 predicted 300
4 SASI_Hs02_00327817 predicted 255
5 SASI_Hs02_00327818 predicted 303
6 SASI_Hs02_00327819 predicted 381
7 SASI_Hs02_00327820 predicted 347
8 SASI_Hs02_00327821 predicted 204
9 SASI_Hs02_00327822 predicted 266
10 SASI_Hs02_00327823 predicted 242
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_209104 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00264085 predicted 277
2 SASI_Hs01_00264086 predicted 368
3 SASI_Hs01_00264087 predicted 300
4 SASI_Hs01_00264088 predicted 296
5 SASI_Hs01_00264089 predicted 386
6 SASI_Hs01_00264090 predicted 343
7 SASI_Hs01_00264091 predicted 266
8 SASI_Hs01_00264092 predicted 245
9 SASI_Hs01_00264093 predicted 367
10 SASI_Hs01_00264094 predicted 290
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001123366
HMSD MISSION shRNA Bacterial Glycerol Stock
histocompatibility (minor) serpin domain containing
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123366.1-460s21c1
Sequence:CCGGTAAACTCCTGGGTTGCTGATACTCGAGTATCAGCAACCCAGGAGTTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123366.1-378s21c1
Sequence:CCGGACAGATTCCTGTGGCAAATTCCTCGAGGAATTTGCCACAGGAATCTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123366.1-252s21c1
Sequence:CCGGGATGGAGATATTCATCGAGGTCTCGAGACCTCGATGAATATCTCCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123366.1-431s21c1
Sequence:CCGGGAATGATACAGAGAAGTCCACCTCGAGGTGGACTTCTCTGTATCATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123366.1-395s21c1
Sequence:CCGGATTCTACCAAGCAACGATAAACTCGAGTTTATCGTTGCTTGGTAGAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001123366
HMSD MISSION shRNA shRNA Plasmid DNA
histocompatibility (minor) serpin domain containing
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123366.1-460s21c1
Sequence:CCGGTAAACTCCTGGGTTGCTGATACTCGAGTATCAGCAACCCAGGAGTTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123366.1-378s21c1
Sequence:CCGGACAGATTCCTGTGGCAAATTCCTCGAGGAATTTGCCACAGGAATCTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123366.1-252s21c1
Sequence:CCGGGATGGAGATATTCATCGAGGTCTCGAGACCTCGATGAATATCTCCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123366.1-431s21c1
Sequence:CCGGGAATGATACAGAGAAGTCCACCTCGAGGTGGACTTCTCTGTATCATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123366.1-395s21c1
Sequence:CCGGATTCTACCAAGCAACGATAAACTCGAGTTTATCGTTGCTTGGTAGAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001123366
HMSD MISSION shRNA Lentiviral Transduction Particles
histocompatibility (minor) serpin domain containing
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123366.1-460s21c1
Sequence:CCGGTAAACTCCTGGGTTGCTGATACTCGAGTATCAGCAACCCAGGAGTTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123366.1-378s21c1
Sequence:CCGGACAGATTCCTGTGGCAAATTCCTCGAGGAATTTGCCACAGGAATCTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123366.1-252s21c1
Sequence:CCGGGATGGAGATATTCATCGAGGTCTCGAGACCTCGATGAATATCTCCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123366.1-431s21c1
Sequence:CCGGGAATGATACAGAGAAGTCCACCTCGAGGTGGACTTCTCTGTATCATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123366.1-395s21c1
Sequence:CCGGATTCTACCAAGCAACGATAAACTCGAGTTTATCGTTGCTTGGTAGAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_209104
HMSD MISSION shRNA Bacterial Glycerol Stock
histocompatibility (minor) serpin domain containing
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000052358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_209104.1-304s1c1
Sequence:CCGGCTGACACTGAATATGTGCTTACTCGAGTAAGCACATATTCAGTGTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_209104.1-355s1c1
Sequence:CCGGCTTATGATTTCCTCACAGGTTCTCGAGAACCTGTGAGGAAATCATAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_209104.1-443s1c1
Sequence:CCGGGAAGTCCACAACACGTGTAAACTCGAGTTTACACGTGTTGTGGACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_209104.1-276s1c1
Sequence:CCGGCAGTCACTTCTTGTTGCAATTCTCGAGAATTGCAACAAGAAGTGACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_209104.1-418s1c1
Sequence:CCGGAGCTAGACTTTGTGAATGATACTCGAGTATCATTCACAAAGTCTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_209104
HMSD MISSION shRNA shRNA Plasmid DNA
histocompatibility (minor) serpin domain containing
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000052358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_209104.1-304s1c1
Sequence:CCGGCTGACACTGAATATGTGCTTACTCGAGTAAGCACATATTCAGTGTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_209104.1-355s1c1
Sequence:CCGGCTTATGATTTCCTCACAGGTTCTCGAGAACCTGTGAGGAAATCATAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_209104.1-443s1c1
Sequence:CCGGGAAGTCCACAACACGTGTAAACTCGAGTTTACACGTGTTGTGGACTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_209104.1-276s1c1
Sequence:CCGGCAGTCACTTCTTGTTGCAATTCTCGAGAATTGCAACAAGAAGTGACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_209104.1-418s1c1
Sequence:CCGGAGCTAGACTTTGTGAATGATACTCGAGTATCATTCACAAAGTCTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_209104
HMSD MISSION shRNA Lentiviral Transduction Particles
histocompatibility (minor) serpin domain containing
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000052358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_209104.1-304s1c1
Sequence:CCGGCTGACACTGAATATGTGCTTACTCGAGTAAGCACATATTCAGTGTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_209104.1-355s1c1
Sequence:CCGGCTTATGATTTCCTCACAGGTTCTCGAGAACCTGTGAGGAAATCATAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_209104.1-443s1c1
Sequence:CCGGGAAGTCCACAACACGTGTAAACTCGAGTTTACACGTGTTGTGGACTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_209104.1-276s1c1
Sequence:CCGGCAGTCACTTCTTGTTGCAATTCTCGAGAATTGCAACAAGAAGTGACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_209104.1-418s1c1
Sequence:CCGGAGCTAGACTTTGTGAATGATACTCGAGTATCATTCACAAAGTCTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)