EMAIL THIS PAGE TO A FRIEND

HMX3

H6 family homeobox 3

59 Gene Product Result for
Synonyms: NKX-5.1 NKX5.1 Nkx5-1
UniProtKB ID: A6NHT5, A8MU06
Gene ID:
Mouse(15373) H6 homeobox 3
Rat(293537) H6 family homeobox 3
Zebrafish(60310) homeo box (H6 family) 3
chicken(429199) H6 family homeobox 3
domestic cat(101097423) H6 family homeobox 3
cow(522046) H6 family homeobox 3
dog(611245) H6 family homeobox 3
domestic guinea pig(100712708) H6 family homeobox 3
naked mole-rat(101698550) H6 family homeobox 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008257 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008257 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008257 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_291716 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_291716 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_291716 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001105574 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001105574 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001105574 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001105574 Rosetta Predictions human pricing
XM_291716 Rosetta Predictions human pricing
NM_001106302 Rosetta Predictions rat pricing
NM_008257 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105574 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00324541 predicted 641
2 SASI_Hs02_00324542 predicted 511
3 SASI_Hs02_00324543 predicted 533
4 SASI_Hs02_00324544 predicted 442
5 SASI_Hs02_00324545 predicted 637
6 SASI_Hs02_00324546 predicted 637
7 SASI_Hs02_00324547 predicted 610
8 SASI_Hs02_00324548 predicted 508
9 SASI_Hs02_00324549 predicted 500
10 SASI_Hs02_00324550 predicted 663
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_291716 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00297312 predicted 290
2 SASI_Hs01_00297313 predicted 722
3 SASI_Hs01_00297314 predicted 755
4 SASI_Hs01_00297315 predicted 717
5 SASI_Hs01_00297316 predicted 258
6 SASI_Hs01_00297317 predicted 550
7 SASI_Hs01_00297318 predicted 362
8 SASI_Hs01_00297319 predicted 402
9 SASI_Hs01_00297320 predicted 558
10 SASI_Hs01_00297321 predicted 544
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106302 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00217638 predicted 731
2 SASI_Rn02_00217639 predicted 1052
3 SASI_Rn02_00217640 predicted 919
4 SASI_Rn02_00217641 predicted 997
5 SASI_Rn02_00217642 predicted 514
6 SASI_Rn02_00217643 predicted 787
7 SASI_Rn02_00217644 predicted 507
8 SASI_Rn02_00217645 predicted 1209
9 SASI_Rn02_00217646 predicted 1309
10 SASI_Rn02_00217647 predicted 297
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008257 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00098334 predicted 1082
2 SASI_Mm01_00098333 predicted 718
3 SASI_Mm01_00098335 predicted 913
4 SASI_Mm01_00098337 predicted 1048
5 SASI_Mm01_00098340 predicted 719
6 SASI_Mm01_00098341 predicted 904
7 SASI_Mm01_00098342 predicted 996
8 SASI_Mm02_00313464 predicted 784
9 SASI_Mm02_00313465 predicted 508
10 SASI_Mm02_00313466 predicted 920
11 SASI_Mm01_00098336 predicted 285
12 SASI_Mm01_00098338 predicted 294
13 SASI_Mm01_00098339 predicted 322
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008257
HMX3 MISSION shRNA Bacterial Glycerol Stock
H6 family homeobox 3
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000070731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008257.2-282s1c1
Sequence:CCGGCCGCTTTGAGATCCCAGCGCACTCGAGTGCGCTGGGATCTCAAAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008257.2-388s1c1
Sequence:CCGGCCGCGACCAGAAGCCTCGGAACTCGAGTTCCGAGGCTTCTGGTCGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008257.2-903s1c1
Sequence:CCGGGCGCATCGTACGCGTGCCCATCTCGAGATGGGCACGCGTACGATGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008257.2-1011s1c1
Sequence:CCGGGCACCCAGTCTACTACTCGCACTCGAGTGCGAGTAGTAGACTGGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008257.2-726s1c1
Sequence:CCGGCGAGTCCACATTCGACATGAACTCGAGTTCATGTCGAATGTGGACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008257.3-490s21c1
Sequence:CCGGCACAAGGAGCTGGACTCCAAGCTCGAGCTTGGAGTCCAGCTCCTTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008257.3-509s21c1
Sequence:CCGGAGAGCCCGGACGAGATCATTCCTCGAGGAATGATCTCGTCCGGGCTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008257.3-525s21c1
Sequence:CCGGCATTCTGGAAGAGAGCGACTCCTCGAGGAGTCGCTCTCTTCCAGAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008257
HMX3 MISSION shRNA shRNA Plasmid DNA
H6 family homeobox 3
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000070731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008257.2-282s1c1
Sequence:CCGGCCGCTTTGAGATCCCAGCGCACTCGAGTGCGCTGGGATCTCAAAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008257.2-388s1c1
Sequence:CCGGCCGCGACCAGAAGCCTCGGAACTCGAGTTCCGAGGCTTCTGGTCGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008257.2-903s1c1
Sequence:CCGGGCGCATCGTACGCGTGCCCATCTCGAGATGGGCACGCGTACGATGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008257.2-1011s1c1
Sequence:CCGGGCACCCAGTCTACTACTCGCACTCGAGTGCGAGTAGTAGACTGGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008257.2-726s1c1
Sequence:CCGGCGAGTCCACATTCGACATGAACTCGAGTTCATGTCGAATGTGGACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008257.3-490s21c1
Sequence:CCGGCACAAGGAGCTGGACTCCAAGCTCGAGCTTGGAGTCCAGCTCCTTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008257.3-509s21c1
Sequence:CCGGAGAGCCCGGACGAGATCATTCCTCGAGGAATGATCTCGTCCGGGCTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008257.3-525s21c1
Sequence:CCGGCATTCTGGAAGAGAGCGACTCCTCGAGGAGTCGCTCTCTTCCAGAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008257
HMX3 MISSION shRNA Lentiviral Transduction Particles
H6 family homeobox 3
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000070731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008257.2-282s1c1
Sequence:CCGGCCGCTTTGAGATCCCAGCGCACTCGAGTGCGCTGGGATCTCAAAGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008257.2-388s1c1
Sequence:CCGGCCGCGACCAGAAGCCTCGGAACTCGAGTTCCGAGGCTTCTGGTCGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008257.2-903s1c1
Sequence:CCGGGCGCATCGTACGCGTGCCCATCTCGAGATGGGCACGCGTACGATGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008257.2-1011s1c1
Sequence:CCGGGCACCCAGTCTACTACTCGCACTCGAGTGCGAGTAGTAGACTGGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008257.2-726s1c1
Sequence:CCGGCGAGTCCACATTCGACATGAACTCGAGTTCATGTCGAATGTGGACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008257.3-490s21c1
Sequence:CCGGCACAAGGAGCTGGACTCCAAGCTCGAGCTTGGAGTCCAGCTCCTTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008257.3-509s21c1
Sequence:CCGGAGAGCCCGGACGAGATCATTCCTCGAGGAATGATCTCGTCCGGGCTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008257.3-525s21c1
Sequence:CCGGCATTCTGGAAGAGAGCGACTCCTCGAGGAGTCGCTCTCTTCCAGAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_291716
HMX3 MISSION shRNA Bacterial Glycerol Stock
H6 family homeobox 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000015909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291716.4-67s1c1
Sequence:CCGGGAGTGGAATGTCCTTTCACTACTCGAGTAGTGAAAGGACATTCCACTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291716.4-221s1c1
Sequence:CCGGCGTTAGTTAGACAGCTCCAAACTCGAGTTTGGAGCTGTCTAACTAACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291716.4-1347s1c1
Sequence:CCGGGCCCATCCTCTACCACGAGAACTCGAGTTCTCGTGGTAGAGGATGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291716.4-697s1c1
Sequence:CCGGGACCTGGCTTTCCCTCGCTTTCTCGAGAAAGCGAGGGAAAGCCAGGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291716.4-107s1c1
Sequence:CCGGAGTGTGGTTCTCTAAGGACTTCTCGAGAAGTCCTTAGAGAACCACACTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_291716
HMX3 MISSION shRNA shRNA Plasmid DNA
H6 family homeobox 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000015909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291716.4-67s1c1
Sequence:CCGGGAGTGGAATGTCCTTTCACTACTCGAGTAGTGAAAGGACATTCCACTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291716.4-221s1c1
Sequence:CCGGCGTTAGTTAGACAGCTCCAAACTCGAGTTTGGAGCTGTCTAACTAACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291716.4-1347s1c1
Sequence:CCGGGCCCATCCTCTACCACGAGAACTCGAGTTCTCGTGGTAGAGGATGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291716.4-697s1c1
Sequence:CCGGGACCTGGCTTTCCCTCGCTTTCTCGAGAAAGCGAGGGAAAGCCAGGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291716.4-107s1c1
Sequence:CCGGAGTGTGGTTCTCTAAGGACTTCTCGAGAAGTCCTTAGAGAACCACACTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_291716
HMX3 MISSION shRNA Lentiviral Transduction Particles
H6 family homeobox 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000015909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291716.4-67s1c1
Sequence:CCGGGAGTGGAATGTCCTTTCACTACTCGAGTAGTGAAAGGACATTCCACTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291716.4-221s1c1
Sequence:CCGGCGTTAGTTAGACAGCTCCAAACTCGAGTTTGGAGCTGTCTAACTAACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291716.4-1347s1c1
Sequence:CCGGGCCCATCCTCTACCACGAGAACTCGAGTTCTCGTGGTAGAGGATGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291716.4-697s1c1
Sequence:CCGGGACCTGGCTTTCCCTCGCTTTCTCGAGAAAGCGAGGGAAAGCCAGGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291716.4-107s1c1
Sequence:CCGGAGTGTGGTTCTCTAAGGACTTCTCGAGAAGTCCTTAGAGAACCACACTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001105574
HMX3 MISSION shRNA Bacterial Glycerol Stock
H6 family homeobox 3
Human
1 Products Total
TRC Number Price Set Price (1)? Select
TRCN0000454252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105574.1-101s21c1
Sequence:CCGGAGAACCTGCTCAACGGAGACCCTCGAGGGTCTCCGTTGAGCAGGTTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001105574
HMX3 MISSION shRNA shRNA Plasmid DNA
H6 family homeobox 3
Human
1 Products Total
TRC Number Vector Price Set Price (1)? Select
TRCN0000454252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105574.1-101s21c1
Sequence:CCGGAGAACCTGCTCAACGGAGACCCTCGAGGGTCTCCGTTGAGCAGGTTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001105574
HMX3 MISSION shRNA Lentiviral Transduction Particles
H6 family homeobox 3
Human
1 Products Total
TRC Number Volume Titer Vector Price Set Price (1)? Select
TRCN0000454252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105574.1-101s21c1
Sequence:CCGGAGAACCTGCTCAACGGAGACCCTCGAGGGTCTCCGTTGAGCAGGTTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)