EMAIL THIS PAGE TO A FRIEND

HN1

hematological and neurological expressed 1

159 Gene Product Result for
Synonyms: ARM2 HN1A
UniProtKB ID: Q9UK76, B2R6K3, Q53FG7, Q7Z2D2, Q7Z2F0
Gene ID:
Mouse(15374) hematological and neurological expressed sequence 1
Rat(287828) hematological and neurological expressed 1
chicken(422119) hematological and neurological expressed 1
domestic cat(101098099) hematological and neurological expressed 1
cow(613381) hematological and neurological expressed 1
dog(450237) hematological and neurological expressed 1
domestic guinea pig(100719480) hematological and neurological expressed 1
naked mole-rat(101710998) hematological and neurological expressed 1
sheep(101111302) hematological and neurological expressed 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001002032 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001002032 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001002032 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008258 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008258 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008258 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016185 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016185 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016185 MISSION® shRNA Lentiviral Transduction Particles human pricing

Related Products

Product # Description Species Add to Cart
 
MAB5352 Anti-Notch 1 Antibody, clone mN1A Anti-Notch 1 Antibody, clone mN1A is a high quality Mouse Monoclonal Antibody for the detection of Notch 1 & has been validated in ICC, IHC, IP & WB. pricing
ABS90 Anti-Notch 1 Antibody, extracellular Anti-Notch 1 Antibody, extracellular detects level of Notch 1 & has been published & validated for use in WB, IH(P). pricing
MAB5414 Anti-Notch 1 Antibody, extracellular, clone 8G10 Use Anti-Notch 1 Antibody, extracellular, clone 8G10 (Syrian Hamster Monoclonal Antibody) validated in FC, WB, IHC to detect Notch 1 also known as Motch A, mT14, p300. pricing
07-1232 Anti-Notch 1 Antibody, NT Anti-Notch 1 Antibody, N-Terminus is a Rabbit Polyclonal Antibody for detection of Notch 1 also known as Neurogenic locus notch homolog protein 1 precursor & has been validated in ELISA, WB, IHC(P). pricing
07-218 Anti-Notch1 Antibody, extracellular domain Anti-Notch1 Antibody, extracellular domain is a high quality Rabbit Polyclonal Antibody for the detection of Notch1 & has been validated in WB. pricing
07-1231 Anti-Notch1 Antibody, Intracellular Use Anti-Notch1 Antibody, Intracellular (Rabbit Polyclonal Antibody) validated in ELISA, WB, IHC(P) to detect Notch1 also known as Neurogenic locus notch homolog protein 1 precursor. pricing
FCMAB260PE Milli-Mark™ Anti-Notch 1-PE Antibody, clone mN1A Milli-Mark Anti-Notch 1-PE Antibody, clone mN1A detects level of Notch 1 & has been published & validated for use in FC. pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001002032 Rosetta Predictions human pricing
NM_001002033 Rosetta Predictions human pricing
NM_016185 Rosetta Predictions human pricing
NM_001005876 Rosetta Predictions rat pricing
NM_008258 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002032 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00166506 predicted 1081
2 SASI_Hs01_00166507 predicted 1320
3 SASI_Hs02_00304103 predicted 1119
4 SASI_Hs01_00166508 predicted 1183
5 SASI_Hs01_00166509 predicted 1191
6 SASI_Hs01_00166511 predicted 1190
7 SASI_Hs01_00166510 predicted 1161
8 SASI_Hs01_00166512 predicted 780
9 SASI_Hs02_00304104 predicted 803
10 SASI_Hs01_00166514 predicted 422
11 SASI_Hs01_00166513 predicted 796
12 SASI_Hs01_00166515 predicted 393
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002033 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00219856 predicted 1190
2 SASI_Hs02_00304105 predicted 1239
3 SASI_Hs01_00219857 predicted 1303
4 SASI_Hs01_00219858 predicted 1297
5 SASI_Hs01_00219860 predicted 1302
6 SASI_Hs01_00219859 predicted 1284
7 SASI_Hs01_00219861 predicted 897
8 SASI_Hs01_00219862 predicted 917
9 SASI_Hs01_00219864 predicted 513
10 SASI_Hs01_00219865 predicted 1169
11 SASI_Hs01_00219863 predicted 916
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016185 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00153345 predicted 1101
2 SASI_Hs02_00349015 predicted 1139
3 SASI_Hs01_00153346 predicted 1208
4 SASI_Hs01_00153347 predicted 1206
5 SASI_Hs01_00153349 predicted 1213
6 SASI_Hs01_00153348 predicted 1182
7 SASI_Hs01_00153350 predicted 800
8 SASI_Hs02_00349016 predicted 827
9 SASI_Hs01_00153352 predicted 422
10 SASI_Hs01_00153354 predicted 1079
11 SASI_Hs01_00153351 predicted 822
12 SASI_Hs01_00153353 predicted 393
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005876 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00070143 predicted 986
2 SASI_Rn01_00070144 predicted 375
3 SASI_Rn01_00070145 predicted 315
4 SASI_Rn01_00070146 predicted 373
5 SASI_Rn01_00070147 predicted 660
6 SASI_Rn01_00070148 predicted 651
7 SASI_Rn01_00070149 predicted 1008
8 SASI_Rn01_00070150 predicted 840
9 SASI_Rn01_00070152 predicted 815
10 SASI_Rn02_00198450 predicted 977
11 SASI_Rn01_00070151 predicted 808
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008258 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00115020 predicted 830
2 SASI_Mm01_00115022 predicted 772
3 SASI_Mm01_00115024 predicted 768
4 SASI_Mm02_00313467 predicted 277
5 SASI_Mm01_00115026 predicted 993
6 SASI_Mm02_00313468 predicted 362
7 SASI_Mm02_00313469 predicted 762
8 SASI_Mm02_00313470 predicted 715
9 SASI_Mm02_00313471 predicted 331
10 SASI_Mm02_00313472 predicted 954
11 SASI_Mm01_00115021 predicted 551
12 SASI_Mm01_00115023 predicted 337
13 SASI_Mm01_00115025 predicted 652
14 SASI_Mm01_00115027 predicted 424
15 SASI_Mm01_00115028 predicted 395
16 SASI_Mm01_00115029 predicted 640
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001002032
VALIDATED
HN1 MISSION shRNA Bacterial Glycerol Stock
hematological and neurological expressed 1
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000343637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002032.1-395s21c1
Sequence:CCGGCAGAACAACCTGTGAGGAAGACTCGAGTCTTCCTCACAGGTTGTTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002032.1-792s21c1
Sequence:CCGGGAGCCTGACTGTACATCTCTTCTCGAGAAGAGATGTACAGTCAGGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002032.1-768s21c1
Sequence:CCGGCCATGCTTGTGAACTGCACAACTCGAGTTGTGCAGTTCACAAGCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002032.1-724s21c1
Sequence:CCGGGTTAGCTCTGACTGTCCTGAACTCGAGTTCAGGACAGTCAGAGCTAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002032.1-751s21c1
Sequence:CCGGCGTTCTGTCTGTTTCCTCCATCTCGAGATGGAGGAAACAGACAGAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144649    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002032.1-798s1c1
Sequence:CCGGGACTGTACATCTCTTGGATTTCTCGAGAAATCCAAGAGATGTACAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144337    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001002032.1-1243s1c1
Sequence:CCGGCAAAGCAAAGAAACTGCCTTTCTCGAGAAAGGCAGTTTCTTTGCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143748    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001002032.1-1002s1c1
Sequence:CCGGCCAGATGTGTTAGAGGATCTTCTCGAGAAGATCCTCTAACACATCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001002032.1-792s1c1
Sequence:CCGGGAGCCTGACTGTACATCTCTTCTCGAGAAGAGATGTACAGTCAGGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001002032.1-724s1c1
Sequence:CCGGGTTAGCTCTGACTGTCCTGAACTCGAGTTCAGGACAGTCAGAGCTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001002032.1-751s1c1
Sequence:CCGGCGTTCTGTCTGTTTCCTCCATCTCGAGATGGAGGAAACAGACAGAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139039    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001002032.1-1063s1c1
Sequence:CCGGCCTCAACTGGACAGACCATAACTCGAGTTATGGTCTGTCCAGTTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139175    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002032.1-392s1c1
Sequence:CCGGCAACAGAACAACCTGTGAGGACTCGAGTCCTCACAGGTTGTTCTGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001002032.1-768s1c1
Sequence:CCGGCCATGCTTGTGAACTGCACAACTCGAGTTGTGCAGTTCACAAGCATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140841    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002032.1-529s1c1
Sequence:CCGGCAGAGAAGGAACTCCTCTGAACTCGAGTTCAGAGGAGTTCCTTCTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001002032
VALIDATED
HN1 MISSION shRNA shRNA Plasmid DNA
hematological and neurological expressed 1
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000343637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002032.1-395s21c1
Sequence:CCGGCAGAACAACCTGTGAGGAAGACTCGAGTCTTCCTCACAGGTTGTTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002032.1-792s21c1
Sequence:CCGGGAGCCTGACTGTACATCTCTTCTCGAGAAGAGATGTACAGTCAGGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002032.1-768s21c1
Sequence:CCGGCCATGCTTGTGAACTGCACAACTCGAGTTGTGCAGTTCACAAGCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002032.1-724s21c1
Sequence:CCGGGTTAGCTCTGACTGTCCTGAACTCGAGTTCAGGACAGTCAGAGCTAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002032.1-751s21c1
Sequence:CCGGCGTTCTGTCTGTTTCCTCCATCTCGAGATGGAGGAAACAGACAGAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144649    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002032.1-798s1c1
Sequence:CCGGGACTGTACATCTCTTGGATTTCTCGAGAAATCCAAGAGATGTACAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144337    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001002032.1-1243s1c1
Sequence:CCGGCAAAGCAAAGAAACTGCCTTTCTCGAGAAAGGCAGTTTCTTTGCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143748    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001002032.1-1002s1c1
Sequence:CCGGCCAGATGTGTTAGAGGATCTTCTCGAGAAGATCCTCTAACACATCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001002032.1-792s1c1
Sequence:CCGGGAGCCTGACTGTACATCTCTTCTCGAGAAGAGATGTACAGTCAGGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001002032.1-724s1c1
Sequence:CCGGGTTAGCTCTGACTGTCCTGAACTCGAGTTCAGGACAGTCAGAGCTAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001002032.1-751s1c1
Sequence:CCGGCGTTCTGTCTGTTTCCTCCATCTCGAGATGGAGGAAACAGACAGAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139039    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001002032.1-1063s1c1
Sequence:CCGGCCTCAACTGGACAGACCATAACTCGAGTTATGGTCTGTCCAGTTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139175    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002032.1-392s1c1
Sequence:CCGGCAACAGAACAACCTGTGAGGACTCGAGTCCTCACAGGTTGTTCTGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001002032.1-768s1c1
Sequence:CCGGCCATGCTTGTGAACTGCACAACTCGAGTTGTGCAGTTCACAAGCATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140841    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002032.1-529s1c1
Sequence:CCGGCAGAGAAGGAACTCCTCTGAACTCGAGTTCAGAGGAGTTCCTTCTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001002032
VALIDATED
HN1 MISSION shRNA Lentiviral Transduction Particles
hematological and neurological expressed 1
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000343637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002032.1-395s21c1
Sequence:CCGGCAGAACAACCTGTGAGGAAGACTCGAGTCTTCCTCACAGGTTGTTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002032.1-792s21c1
Sequence:CCGGGAGCCTGACTGTACATCTCTTCTCGAGAAGAGATGTACAGTCAGGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002032.1-768s21c1
Sequence:CCGGCCATGCTTGTGAACTGCACAACTCGAGTTGTGCAGTTCACAAGCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002032.1-724s21c1
Sequence:CCGGGTTAGCTCTGACTGTCCTGAACTCGAGTTCAGGACAGTCAGAGCTAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002032.1-751s21c1
Sequence:CCGGCGTTCTGTCTGTTTCCTCCATCTCGAGATGGAGGAAACAGACAGAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144649    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002032.1-798s1c1
Sequence:CCGGGACTGTACATCTCTTGGATTTCTCGAGAAATCCAAGAGATGTACAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144337    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001002032.1-1243s1c1
Sequence:CCGGCAAAGCAAAGAAACTGCCTTTCTCGAGAAAGGCAGTTTCTTTGCTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143748    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001002032.1-1002s1c1
Sequence:CCGGCCAGATGTGTTAGAGGATCTTCTCGAGAAGATCCTCTAACACATCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001002032.1-792s1c1
Sequence:CCGGGAGCCTGACTGTACATCTCTTCTCGAGAAGAGATGTACAGTCAGGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001002032.1-724s1c1
Sequence:CCGGGTTAGCTCTGACTGTCCTGAACTCGAGTTCAGGACAGTCAGAGCTAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001002032.1-751s1c1
Sequence:CCGGCGTTCTGTCTGTTTCCTCCATCTCGAGATGGAGGAAACAGACAGAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139039    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001002032.1-1063s1c1
Sequence:CCGGCCTCAACTGGACAGACCATAACTCGAGTTATGGTCTGTCCAGTTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139175    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002032.1-392s1c1
Sequence:CCGGCAACAGAACAACCTGTGAGGACTCGAGTCCTCACAGGTTGTTCTGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001002032.1-768s1c1
Sequence:CCGGCCATGCTTGTGAACTGCACAACTCGAGTTGTGCAGTTCACAAGCATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140841    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002032.1-529s1c1
Sequence:CCGGCAGAGAAGGAACTCCTCTGAACTCGAGTTCAGAGGAGTTCCTTCTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008258
HN1 MISSION shRNA Bacterial Glycerol Stock
hematological and neurological expressed 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000176148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008258.1-346s1c1
Sequence:CCGGGAAGTAACTCTTCTGAAGCAACTCGAGTTGCTTCAGAAGAGTTACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008258.1-224s1c1
Sequence:CCGGGAAGAACAAGATGGCTTCTAACTCGAGTTAGAAGCCATCTTGTTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008258.1-230s1c1
Sequence:CCGGCAAGATGGCTTCTAACATCTTCTCGAGAAGATGTTAGAAGCCATCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008258.1-394s1c1
Sequence:CCGGGAGAAGGTGATATGCATGAAACTCGAGTTTCATGCATATCACCTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193650    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008258.1-342s1c1
Sequence:CCGGCAGAGAAGTAACTCTTCTGAACTCGAGTTCAGAAGAGTTACTTCTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008258
HN1 MISSION shRNA shRNA Plasmid DNA
hematological and neurological expressed 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000176148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008258.1-346s1c1
Sequence:CCGGGAAGTAACTCTTCTGAAGCAACTCGAGTTGCTTCAGAAGAGTTACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008258.1-224s1c1
Sequence:CCGGGAAGAACAAGATGGCTTCTAACTCGAGTTAGAAGCCATCTTGTTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008258.1-230s1c1
Sequence:CCGGCAAGATGGCTTCTAACATCTTCTCGAGAAGATGTTAGAAGCCATCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008258.1-394s1c1
Sequence:CCGGGAGAAGGTGATATGCATGAAACTCGAGTTTCATGCATATCACCTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193650    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008258.1-342s1c1
Sequence:CCGGCAGAGAAGTAACTCTTCTGAACTCGAGTTCAGAAGAGTTACTTCTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008258
HN1 MISSION shRNA Lentiviral Transduction Particles
hematological and neurological expressed 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000176148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008258.1-346s1c1
Sequence:CCGGGAAGTAACTCTTCTGAAGCAACTCGAGTTGCTTCAGAAGAGTTACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008258.1-224s1c1
Sequence:CCGGGAAGAACAAGATGGCTTCTAACTCGAGTTAGAAGCCATCTTGTTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008258.1-230s1c1
Sequence:CCGGCAAGATGGCTTCTAACATCTTCTCGAGAAGATGTTAGAAGCCATCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008258.1-394s1c1
Sequence:CCGGGAGAAGGTGATATGCATGAAACTCGAGTTTCATGCATATCACCTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193650    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008258.1-342s1c1
Sequence:CCGGCAGAGAAGTAACTCTTCTGAACTCGAGTTCAGAAGAGTTACTTCTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016185
VALIDATED
HN1 MISSION shRNA Bacterial Glycerol Stock
hematological and neurological expressed 1
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000122607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_016185.1-144s1c1
Sequence:CCGGGCAGGAATAGCTCCCGAGTTTCTCGAGAAACTCGGGAGCTATTCCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016185.1-216s1c1
Sequence:CCGGCAGAACAACCTGTGAGGAAGACTCGAGTCTTCCTCACAGGTTGTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016185.1-321s1c1
Sequence:CCGGGCAGGGAAGACTTGGAGTCATCTCGAGATGACTCCAAGTCTTCCCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016185
VALIDATED
HN1 MISSION shRNA shRNA Plasmid DNA
hematological and neurological expressed 1
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000122607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_016185.1-144s1c1
Sequence:CCGGGCAGGAATAGCTCCCGAGTTTCTCGAGAAACTCGGGAGCTATTCCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016185.1-216s1c1
Sequence:CCGGCAGAACAACCTGTGAGGAAGACTCGAGTCTTCCTCACAGGTTGTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016185.1-321s1c1
Sequence:CCGGGCAGGGAAGACTTGGAGTCATCTCGAGATGACTCCAAGTCTTCCCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016185
VALIDATED
HN1 MISSION shRNA Lentiviral Transduction Particles
hematological and neurological expressed 1
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000122607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_016185.1-144s1c1
Sequence:CCGGGCAGGAATAGCTCCCGAGTTTCTCGAGAAACTCGGGAGCTATTCCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016185.1-216s1c1
Sequence:CCGGCAGAACAACCTGTGAGGAAGACTCGAGTCTTCCTCACAGGTTGTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016185.1-321s1c1
Sequence:CCGGGCAGGGAAGACTTGGAGTCATCTCGAGATGACTCCAAGTCTTCCCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)