EMAIL THIS PAGE TO A FRIEND

HN1L

hematological and neurological expressed 1-like

59 Gene Product Result for
Synonyms: C16orf34 L11
UniProtKB ID: Q9H910, B1AJY2, Q6EIC7
Gene ID:
Mouse(52009) hematological and neurological expressed 1-like
Rat(360492) hematological and neurological expressed 1-like
Zebrafish(321880) hematological and neurological expressed 1-like
dog(611128) hematological and neurological expressed 1-like
domestic cat(101084505) hematological and neurological expressed 1-like
cow(618512) hematological and neurological expressed 1-like
chicken(416763) hematological and neurological expressed 1-like
sheep(101110020) hematological and neurological expressed 1-like
domestic guinea pig(100725695) hematological and neurological expressed 1-like
naked mole-rat(101715732) hematological and neurological expressed 1-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198937 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198937 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198937 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_144570 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144570 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144570 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU228371 MISSION® esiRNA esiRNA targeting human HN1L human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144570 Rosetta Predictions human pricing
NM_001013182 Rosetta Predictions rat pricing
NM_198937 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144570 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00190074 predicted 230
2 SASI_Hs01_00190075 predicted 998
3 SASI_Hs02_00364341 predicted 689
4 SASI_Hs01_00190076 predicted 923
5 SASI_Hs01_00190077 predicted 699
6 SASI_Hs01_00190078 predicted 356
7 SASI_Hs01_00190079 predicted 291
8 SASI_Hs01_00190080 predicted 1052
9 SASI_Hs01_00190081 predicted 566
10 SASI_Hs01_00190082 predicted 650
11 SASI_Hs01_00190083 predicted 998
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013182 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00097501 predicted 622
2 SASI_Rn01_00097502 predicted 857
3 SASI_Rn01_00097503 predicted 813
4 SASI_Rn01_00097504 predicted 627
5 SASI_Rn02_00200939 predicted 619
6 SASI_Rn01_00097505 predicted 609
7 SASI_Rn01_00097507 predicted 605
8 SASI_Rn01_00097508 predicted 372
9 SASI_Rn01_00097509 predicted 621
10 SASI_Rn02_00200940 predicted 452
11 SASI_Rn01_00097506 predicted 598
12 SASI_Rn01_00097510 predicted 220
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198937 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00176940 predicted 915
2 SASI_Mm02_00351240 predicted 612
3 SASI_Mm01_00176943 predicted 830
4 SASI_Mm02_00351241 predicted 1020
5 SASI_Mm01_00176944 predicted 615
6 SASI_Mm02_00351242 predicted 1024
7 SASI_Mm01_00176945 predicted 1065
8 SASI_Mm01_00176946 predicted 227
9 SASI_Mm01_00176947 predicted 1026
10 SASI_Mm01_00176948 predicted 617
11 SASI_Mm01_00176941 predicted 1085
12 SASI_Mm01_00176942 predicted 806
13 SASI_Mm01_00176949 predicted 1002
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198937
VALIDATED
HN1L MISSION shRNA Bacterial Glycerol Stock
hematological and neurological expressed 1-like
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000194537    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198937.1-2088s1c1
Sequence:CCGGGCCAAGTAACAGGTCTTACATCTCGAGATGTAAGACCTGTTACTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194189    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198937.1-101s1c1
Sequence:CCGGGTCCAGAAGAAGGTATTTCTTCTCGAGAAGAAATACCTTCTTCTGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198937.1-98s1c1
Sequence:CCGGGAAGTCCAGAAGAAGGTATTTCTCGAGAAATACCTTCTTCTGGACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198937.1-484s1c1
Sequence:CCGGCCTACAGTTGACAGTCATGAACTCGAGTTCATGACTGTCAACTGTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173398    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198937.1-1491s1c1
Sequence:CCGGGCTCCTATAATTGGGAGGAAACTCGAGTTTCCTCCCAATTATAGGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198937.1-74s1c1
Sequence:CCGGGAGGAGAATCGAGCGATCTTTCTCGAGAAAGATCGCTCGATTCTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198937.1-113s1c1
Sequence:CCGGGTATTTCTTCAAGCAAGCCTACTCGAGTAGGCTTGCTTGAAGAAATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174476    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198937.1-131s1c1
Sequence:CCGGCTAATAGGATGGCATCTAATACTCGAGTATTAGATGCCATCCTATTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198937
VALIDATED
HN1L MISSION shRNA shRNA Plasmid DNA
hematological and neurological expressed 1-like
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000194537    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198937.1-2088s1c1
Sequence:CCGGGCCAAGTAACAGGTCTTACATCTCGAGATGTAAGACCTGTTACTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194189    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198937.1-101s1c1
Sequence:CCGGGTCCAGAAGAAGGTATTTCTTCTCGAGAAGAAATACCTTCTTCTGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198937.1-98s1c1
Sequence:CCGGGAAGTCCAGAAGAAGGTATTTCTCGAGAAATACCTTCTTCTGGACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198937.1-484s1c1
Sequence:CCGGCCTACAGTTGACAGTCATGAACTCGAGTTCATGACTGTCAACTGTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173398    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198937.1-1491s1c1
Sequence:CCGGGCTCCTATAATTGGGAGGAAACTCGAGTTTCCTCCCAATTATAGGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198937.1-74s1c1
Sequence:CCGGGAGGAGAATCGAGCGATCTTTCTCGAGAAAGATCGCTCGATTCTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198937.1-113s1c1
Sequence:CCGGGTATTTCTTCAAGCAAGCCTACTCGAGTAGGCTTGCTTGAAGAAATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174476    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198937.1-131s1c1
Sequence:CCGGCTAATAGGATGGCATCTAATACTCGAGTATTAGATGCCATCCTATTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198937
VALIDATED
HN1L MISSION shRNA Lentiviral Transduction Particles
hematological and neurological expressed 1-like
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000194537    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198937.1-2088s1c1
Sequence:CCGGGCCAAGTAACAGGTCTTACATCTCGAGATGTAAGACCTGTTACTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194189    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198937.1-101s1c1
Sequence:CCGGGTCCAGAAGAAGGTATTTCTTCTCGAGAAGAAATACCTTCTTCTGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198937.1-98s1c1
Sequence:CCGGGAAGTCCAGAAGAAGGTATTTCTCGAGAAATACCTTCTTCTGGACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198937.1-484s1c1
Sequence:CCGGCCTACAGTTGACAGTCATGAACTCGAGTTCATGACTGTCAACTGTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173398    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198937.1-1491s1c1
Sequence:CCGGGCTCCTATAATTGGGAGGAAACTCGAGTTTCCTCCCAATTATAGGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198937.1-74s1c1
Sequence:CCGGGAGGAGAATCGAGCGATCTTTCTCGAGAAAGATCGCTCGATTCTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198937.1-113s1c1
Sequence:CCGGGTATTTCTTCAAGCAAGCCTACTCGAGTAGGCTTGCTTGAAGAAATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174476    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198937.1-131s1c1
Sequence:CCGGCTAATAGGATGGCATCTAATACTCGAGTATTAGATGCCATCCTATTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144570
VALIDATED
HN1L MISSION shRNA Bacterial Glycerol Stock
hematological and neurological expressed 1-like
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000072553    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144570.2-2780s1c1
Sequence:CCGGGCCTGTATTTGGAAGATTTAACTCGAGTTAAATCTTCCAAATACAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_144570.2-153s1c1
Sequence:CCGGGCCTAATAGGATGGCATCTAACTCGAGTTAGATGCCATCCTATTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_144570.2-242s1c1
Sequence:CCGGGTGGTATCTTTGACGAATCAACTCGAGTTGATTCGTCAAAGATACCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144570.2-355s1c1
Sequence:CCGGCACCCAAACAAACCCAAGGATCTCGAGATCCTTGGGTTTGTTTGGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144570.2-410s1c1
Sequence:CCGGCGGATCTTAAAGCTGCAAGGACTCGAGTCCTTGCAGCTTTAAGATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_144570.2-299s21c1
Sequence:CCGGGAGGGAAGACCAGCGACATTTCTCGAGAAATGTCGCTGGTCTTCCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293215    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_144570.2-699s21c1
Sequence:CCGGTGGGAAGAGGGTTAGTCTTATCTCGAGATAAGACTAACCCTCTTCCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_144570.2-203s21c1
Sequence:CCGGACATACCCAAGAGGACAAATCCTCGAGGATTTGTCCTCTTGGGTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_144570.2-590s21c1
Sequence:CCGGCCAGCATCTCCTTCTACTAAGCTCGAGCTTAGTAGAAGGAGATGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_144570.2-242s21c1
Sequence:CCGGGTGGTATCTTTGACGAATCAACTCGAGTTGATTCGTCAAAGATACCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144570
VALIDATED
HN1L MISSION shRNA shRNA Plasmid DNA
hematological and neurological expressed 1-like
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000072553    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144570.2-2780s1c1
Sequence:CCGGGCCTGTATTTGGAAGATTTAACTCGAGTTAAATCTTCCAAATACAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_144570.2-153s1c1
Sequence:CCGGGCCTAATAGGATGGCATCTAACTCGAGTTAGATGCCATCCTATTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_144570.2-242s1c1
Sequence:CCGGGTGGTATCTTTGACGAATCAACTCGAGTTGATTCGTCAAAGATACCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144570.2-355s1c1
Sequence:CCGGCACCCAAACAAACCCAAGGATCTCGAGATCCTTGGGTTTGTTTGGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144570.2-410s1c1
Sequence:CCGGCGGATCTTAAAGCTGCAAGGACTCGAGTCCTTGCAGCTTTAAGATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_144570.2-299s21c1
Sequence:CCGGGAGGGAAGACCAGCGACATTTCTCGAGAAATGTCGCTGGTCTTCCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293215    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_144570.2-699s21c1
Sequence:CCGGTGGGAAGAGGGTTAGTCTTATCTCGAGATAAGACTAACCCTCTTCCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_144570.2-203s21c1
Sequence:CCGGACATACCCAAGAGGACAAATCCTCGAGGATTTGTCCTCTTGGGTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_144570.2-590s21c1
Sequence:CCGGCCAGCATCTCCTTCTACTAAGCTCGAGCTTAGTAGAAGGAGATGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_144570.2-242s21c1
Sequence:CCGGGTGGTATCTTTGACGAATCAACTCGAGTTGATTCGTCAAAGATACCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144570
VALIDATED
HN1L MISSION shRNA Lentiviral Transduction Particles
hematological and neurological expressed 1-like
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000072553    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144570.2-2780s1c1
Sequence:CCGGGCCTGTATTTGGAAGATTTAACTCGAGTTAAATCTTCCAAATACAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_144570.2-153s1c1
Sequence:CCGGGCCTAATAGGATGGCATCTAACTCGAGTTAGATGCCATCCTATTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_144570.2-242s1c1
Sequence:CCGGGTGGTATCTTTGACGAATCAACTCGAGTTGATTCGTCAAAGATACCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144570.2-355s1c1
Sequence:CCGGCACCCAAACAAACCCAAGGATCTCGAGATCCTTGGGTTTGTTTGGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144570.2-410s1c1
Sequence:CCGGCGGATCTTAAAGCTGCAAGGACTCGAGTCCTTGCAGCTTTAAGATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_144570.2-299s21c1
Sequence:CCGGGAGGGAAGACCAGCGACATTTCTCGAGAAATGTCGCTGGTCTTCCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293215    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_144570.2-699s21c1
Sequence:CCGGTGGGAAGAGGGTTAGTCTTATCTCGAGATAAGACTAACCCTCTTCCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_144570.2-203s21c1
Sequence:CCGGACATACCCAAGAGGACAAATCCTCGAGGATTTGTCCTCTTGGGTATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_144570.2-590s21c1
Sequence:CCGGCCAGCATCTCCTTCTACTAAGCTCGAGCTTAGTAGAAGGAGATGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_144570.2-242s21c1
Sequence:CCGGGTGGTATCTTTGACGAATCAACTCGAGTTGATTCGTCAAAGATACCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)