EMAIL THIS PAGE TO A FRIEND

HNF1A

HNF1 homeobox A

53 Gene Product Result for
Synonyms: HNF-1A HNF1 IDDM20 LFB1 MODY3 TCF-1 TCF1
UniProtKB ID: P20823, A5Z2R8, Q2M3H2, Q99861
Gene ID:
Human(6927) Summary: The protein encoded by this gene is a transcription factor required for the expression of several liver-specific genes. The encoded protein functions as a homodimer and binds to the inverted palindrome 5'-GTTAATNATTAAC-3'. Defects in this gene are a cause of maturity onset diabetes of the young type 3 (MODY3) and also can result in the appearance of hepatic adenomas. [provided by RefSeq, Mar 2009]
Mouse(21405) HNF1 homeobox A
Rat(24817) HNF1 homeobox A
Zebrafish(266961) HNF1 homeobox a
dog(486303) HNF1 homeobox A
Horse(100049993) HNF1 homeobox A
cow(503578) HNF1 homeobox A
domestic cat(101098407) HNF1 homeobox A
chicken(416967) HNF1 homeobox A
naked mole-rat(101720629) HNF1 homeobox A
sheep(443207) HNF1 homeobox A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000545 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000545 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000545 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009327 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009327 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009327 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000545 Rosetta Predictions human pricing
NM_012669 Rosetta Predictions rat pricing
NM_009327 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000545 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00018982 predicted 1862
2 SASI_Hs01_00018983 predicted 2149
3 SASI_Hs01_00018984 predicted 2177
4 SASI_Hs01_00018985 predicted 369
5 SASI_Hs01_00018986 predicted 2195
6 SASI_Hs01_00018987 predicted 2049
7 SASI_Hs01_00018988 predicted 2182
8 SASI_Hs01_00018989 predicted 2151
9 SASI_Hs01_00018990 predicted 2298
10 SASI_Hs01_00018991 predicted 1864
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012669 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00079982 predicted 1600
2 SASI_Rn01_00079983 predicted 1554
3 SASI_Rn01_00079985 predicted 2234
4 SASI_Rn02_00259940 predicted 781
5 SASI_Rn01_00079986 predicted 2472
6 SASI_Rn01_00079987 predicted 855
7 SASI_Rn01_00079988 predicted 1109
8 SASI_Rn01_00079989 predicted 250
9 SASI_Rn01_00079990 predicted 911
10 SASI_Rn01_00079991 predicted 2273
11 SASI_Rn01_00079984 predicted 2304
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009327 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00093582 predicted 396
2 SASI_Mm01_00093583 predicted 564
3 SASI_Mm01_00093584 predicted 1389
4 SASI_Mm01_00093585 predicted 2350
5 SASI_Mm01_00093587 predicted 2342
6 SASI_Mm01_00093586 predicted 2042
7 SASI_Mm01_00093588 predicted 416
8 SASI_Mm01_00093589 predicted 679
9 SASI_Mm01_00093590 predicted 1006
10 SASI_Mm01_00093591 predicted 1046
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000545
HNF1A MISSION shRNA Bacterial Glycerol Stock
HNF1 homeobox A
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000421578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000545.5-1009s21c1
Sequence:CCGGAGACTGCAGAAGTACCCTCAACTCGAGTTGAGGGTACTTCTGCAGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000545.5-364s21c1
Sequence:CCGGGTGTGGCGAAGATGGTCAAGTCTCGAGACTTGACCATCTTCGCCACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017193    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000545.3-2369s1c1
Sequence:CCGGCCTTGTTCTGTCACCAATGTACTCGAGTACATTGGTGACAGAACAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000545.3-1039s1c1
Sequence:CCGGGTCCCTTAGTGACAGTGTCTACTCGAGTAGACACTGTCACTAAGGGACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000545.3-1574s1c1
Sequence:CCGGGCTCCCGCAGACTATGCTCATCTCGAGATGAGCATAGTCTGCGGGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000545.3-1865s1c1
Sequence:CCGGCCACAGCGTCATCGAGACCTTCTCGAGAAGGTCTCGATGACGCTGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000545.3-476s1c1
Sequence:CCGGCACTCCCATGAAGACGCAGAACTCGAGTTCTGCGTCTTCATGGGAGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000545
HNF1A MISSION shRNA shRNA Plasmid DNA
HNF1 homeobox A
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000421578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000545.5-1009s21c1
Sequence:CCGGAGACTGCAGAAGTACCCTCAACTCGAGTTGAGGGTACTTCTGCAGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000545.5-364s21c1
Sequence:CCGGGTGTGGCGAAGATGGTCAAGTCTCGAGACTTGACCATCTTCGCCACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017193    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000545.3-2369s1c1
Sequence:CCGGCCTTGTTCTGTCACCAATGTACTCGAGTACATTGGTGACAGAACAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000545.3-1039s1c1
Sequence:CCGGGTCCCTTAGTGACAGTGTCTACTCGAGTAGACACTGTCACTAAGGGACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000545.3-1574s1c1
Sequence:CCGGGCTCCCGCAGACTATGCTCATCTCGAGATGAGCATAGTCTGCGGGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000545.3-1865s1c1
Sequence:CCGGCCACAGCGTCATCGAGACCTTCTCGAGAAGGTCTCGATGACGCTGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000545.3-476s1c1
Sequence:CCGGCACTCCCATGAAGACGCAGAACTCGAGTTCTGCGTCTTCATGGGAGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000545
HNF1A MISSION shRNA Lentiviral Transduction Particles
HNF1 homeobox A
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000421578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000545.5-1009s21c1
Sequence:CCGGAGACTGCAGAAGTACCCTCAACTCGAGTTGAGGGTACTTCTGCAGTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000545.5-364s21c1
Sequence:CCGGGTGTGGCGAAGATGGTCAAGTCTCGAGACTTGACCATCTTCGCCACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017193    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000545.3-2369s1c1
Sequence:CCGGCCTTGTTCTGTCACCAATGTACTCGAGTACATTGGTGACAGAACAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000545.3-1039s1c1
Sequence:CCGGGTCCCTTAGTGACAGTGTCTACTCGAGTAGACACTGTCACTAAGGGACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000545.3-1574s1c1
Sequence:CCGGGCTCCCGCAGACTATGCTCATCTCGAGATGAGCATAGTCTGCGGGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000545.3-1865s1c1
Sequence:CCGGCCACAGCGTCATCGAGACCTTCTCGAGAAGGTCTCGATGACGCTGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000545.3-476s1c1
Sequence:CCGGCACTCCCATGAAGACGCAGAACTCGAGTTCTGCGTCTTCATGGGAGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009327
VALIDATED
HNF1A MISSION shRNA Bacterial Glycerol Stock
HNF1 homeobox A
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000333897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009327.3-566s21c1
Sequence:CCGGGAAGATGGTCAAGTCGTACTTCTCGAGAAGTACGACTTGACCATCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333899    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009327.3-2377s21c1
Sequence:CCGGCCTGCTGTTTAGAATAGGAAACTCGAGTTTCCTATTCTAAACAGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009327.3-2003s21c1
Sequence:CCGGGTATCAGAGTTCCGACTCCAACTCGAGTTGGAGTCGGAACTCTGATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009327.3-1058s21c1
Sequence:CCGGGTTGGCCATGGACACCTATAACTCGAGTTATAGGTGTCCATGGCCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084913    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009327.1-2357s1c1
Sequence:CCGGCCTGCTGTTTAGAATAGGAAACTCGAGTTTCCTATTCTAAACAGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009327.1-546s1c1
Sequence:CCGGGAAGATGGTCAAGTCGTACTTCTCGAGAAGTACGACTTGACCATCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009327.1-1983s1c1
Sequence:CCGGGTATCAGAGTTCCGACTCCAACTCGAGTTGGAGTCGGAACTCTGATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009327.1-1746s1c1
Sequence:CCGGGCTCCCGCAGACCATGTTGATCTCGAGATCAACATGGTCTGCGGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009327.1-2031s1c1
Sequence:CCGGCCATAGTGTCATCGAGACTTTCTCGAGAAAGTCTCGATGACACTATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009327
VALIDATED
HNF1A MISSION shRNA shRNA Plasmid DNA
HNF1 homeobox A
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000333897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009327.3-566s21c1
Sequence:CCGGGAAGATGGTCAAGTCGTACTTCTCGAGAAGTACGACTTGACCATCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333899    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009327.3-2377s21c1
Sequence:CCGGCCTGCTGTTTAGAATAGGAAACTCGAGTTTCCTATTCTAAACAGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009327.3-2003s21c1
Sequence:CCGGGTATCAGAGTTCCGACTCCAACTCGAGTTGGAGTCGGAACTCTGATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009327.3-1058s21c1
Sequence:CCGGGTTGGCCATGGACACCTATAACTCGAGTTATAGGTGTCCATGGCCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084913    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009327.1-2357s1c1
Sequence:CCGGCCTGCTGTTTAGAATAGGAAACTCGAGTTTCCTATTCTAAACAGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009327.1-546s1c1
Sequence:CCGGGAAGATGGTCAAGTCGTACTTCTCGAGAAGTACGACTTGACCATCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009327.1-1983s1c1
Sequence:CCGGGTATCAGAGTTCCGACTCCAACTCGAGTTGGAGTCGGAACTCTGATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009327.1-1746s1c1
Sequence:CCGGGCTCCCGCAGACCATGTTGATCTCGAGATCAACATGGTCTGCGGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009327.1-2031s1c1
Sequence:CCGGCCATAGTGTCATCGAGACTTTCTCGAGAAAGTCTCGATGACACTATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009327
VALIDATED
HNF1A MISSION shRNA Lentiviral Transduction Particles
HNF1 homeobox A
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000333897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009327.3-566s21c1
Sequence:CCGGGAAGATGGTCAAGTCGTACTTCTCGAGAAGTACGACTTGACCATCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333899    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009327.3-2377s21c1
Sequence:CCGGCCTGCTGTTTAGAATAGGAAACTCGAGTTTCCTATTCTAAACAGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009327.3-2003s21c1
Sequence:CCGGGTATCAGAGTTCCGACTCCAACTCGAGTTGGAGTCGGAACTCTGATACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009327.3-1058s21c1
Sequence:CCGGGTTGGCCATGGACACCTATAACTCGAGTTATAGGTGTCCATGGCCAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084913    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009327.1-2357s1c1
Sequence:CCGGCCTGCTGTTTAGAATAGGAAACTCGAGTTTCCTATTCTAAACAGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009327.1-546s1c1
Sequence:CCGGGAAGATGGTCAAGTCGTACTTCTCGAGAAGTACGACTTGACCATCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009327.1-1983s1c1
Sequence:CCGGGTATCAGAGTTCCGACTCCAACTCGAGTTGGAGTCGGAACTCTGATACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009327.1-1746s1c1
Sequence:CCGGGCTCCCGCAGACCATGTTGATCTCGAGATCAACATGGTCTGCGGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009327.1-2031s1c1
Sequence:CCGGCCATAGTGTCATCGAGACTTTCTCGAGAAAGTCTCGATGACACTATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)