EMAIL THIS PAGE TO A FRIEND

HNF4A

hepatocyte nuclear factor 4, alpha

109 Gene Product Result for
Synonyms: HNF4 HNF4a7 HNF4a8 HNF4a9 HNF4alpha MODY MODY1 NR2A1 NR2A21 TCF TCF14
Gene ID:
Human(3172) Summary: The protein encoded by this gene is a nuclear transcription factor which binds DNA as a homodimer. The encoded protein controls the expression of several genes, including hepatocyte nuclear factor 1 alpha, a transcription factor which regulates the expression of several hepatic genes. This gene may play a role in development of the liver, kidney, and intestines. Mutations in this gene have been associated with monogenic autosomal dominant non-insulin-dependent diabetes mellitus type I. Alternative splicing of this gene results in multiple transcript variants encoding several different isoforms. [provided by RefSeq, Apr 2012]
Mouse(15378) hepatic nuclear factor 4, alpha
Rat(25735) hepatocyte nuclear factor 4, alpha
Zebrafish(322358) hepatocyte nuclear factor 4, alpha
cow(509200) hepatocyte nuclear factor 4, alpha
chicken(419198) hepatocyte nuclear factor 4, alpha
dog(485884) hepatocyte nuclear factor 4, alpha
Horse(100056007) hepatocyte nuclear factor 4, alpha
domestic cat(101092841) hepatocyte nuclear factor 4, alpha
domestic guinea pig(100713275) hepatocyte nuclear factor 4, alpha
naked mole-rat(101710133) hepatocyte nuclear factor 4, alpha
sheep(100534656) hepatocyte nuclear factor 4, alpha
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4501408 Anti-HNF4 antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, western blot pricing
SAB4501409 Anti-HNF4 antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, western blot pricing
SAB2500513 Anti-HNF4A antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
SAB1412164 ANTI-HNF4A antibody produced in mouse clone 3C6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1412566 ANTI-HNF4A antibody produced in mouse clone 1F2, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1412567 ANTI-HNF4A antibody produced in mouse clone 1H2, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
HPA004712 Anti-HNF4A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
AV31946 Anti-HNF4A antibody produced in rabbit affinity isolated antibody horse, human, canine, rat, zebrafish, bovine, sheep, rabbit, mouse, guinea pig
western blot pricing
SAB2101055 Anti-HNF4A antibody produced in rabbit affinity isolated antibody rat, guinea pig, canine, horse, human, sheep, rabbit, bovine, mouse, pig, zebrafish
western blot pricing
SAB2104352 Anti-HNF4A antibody produced in rabbit affinity isolated antibody horse, rabbit, canine, mouse, guinea pig, bovine, pig, rat, human, sheep
western blot pricing
SAB4504430 Anti-phospho-HNF4 α (pSer313) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
WH0003172M4 Monoclonal Anti-HNF4A antibody produced in mouse clone 4E2, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1403930 Monoclonal Anti-HNF4A antibody produced in mouse clone 1F12, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000457 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000457 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000457 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008261 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008261 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008261 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000457 Rosetta Predictions human pricing
NM_001030003 Rosetta Predictions human pricing
NM_001030004 Rosetta Predictions human pricing
NM_175914 Rosetta Predictions human pricing
NM_178849 Rosetta Predictions human pricing
NM_178850 Rosetta Predictions human pricing
NM_022180 Rosetta Predictions rat pricing
NM_008261 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000457 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00124507 predicted 417
2 SASI_Hs01_00124508 predicted 781
3 SASI_Hs01_00124509 predicted 501
4 SASI_Hs01_00124510 predicted 691
5 SASI_Hs01_00124511 predicted 563
6 SASI_Hs01_00124512 predicted 460
7 SASI_Hs01_00124513 predicted 609
8 SASI_Hs01_00124514 predicted 487
9 SASI_Hs01_00124515 predicted 425
10 SASI_Hs01_00124516 predicted 634
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001030003 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00181922 predicted 268
2 SASI_Hs01_00181923 predicted 631
3 SASI_Hs01_00181924 predicted 342
4 SASI_Hs01_00181925 predicted 540
5 SASI_Hs01_00181926 predicted 415
6 SASI_Hs01_00181927 predicted 306
7 SASI_Hs01_00181928 predicted 451
8 SASI_Hs01_00181929 predicted 334
9 SASI_Hs01_00181930 predicted 266
10 SASI_Hs01_00181931 predicted 479
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001030004 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00090806 predicted 266
2 SASI_Hs01_00090807 predicted 635
3 SASI_Hs01_00090808 predicted 349
4 SASI_Hs01_00090809 predicted 539
5 SASI_Hs01_00090810 predicted 409
6 SASI_Hs01_00090811 predicted 312
7 SASI_Hs01_00090812 predicted 450
8 SASI_Hs01_00090813 predicted 335
9 SASI_Hs01_00090814 predicted 267
10 SASI_Hs01_00090815 predicted 475
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175914 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00081204 predicted 266
2 SASI_Hs01_00081205 predicted 634
3 SASI_Hs01_00081206 predicted 346
4 SASI_Hs01_00081207 predicted 537
5 SASI_Hs01_00081208 predicted 415
6 SASI_Hs01_00081209 predicted 315
7 SASI_Hs01_00081210 predicted 456
8 SASI_Hs01_00081211 predicted 337
9 SASI_Hs01_00081212 predicted 274
10 SASI_Hs01_00081213 predicted 476
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178849 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00027286 predicted 423
2 SASI_Hs01_00027287 predicted 779
3 SASI_Hs01_00027288 predicted 495
4 SASI_Hs01_00027289 predicted 685
5 SASI_Hs01_00027290 predicted 566
6 SASI_Hs01_00027291 predicted 463
7 SASI_Hs01_00027292 predicted 605
8 SASI_Hs01_00027293 predicted 489
9 SASI_Hs01_00027294 predicted 424
10 SASI_Hs01_00027295 predicted 633
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178850 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00200176 predicted 424
2 SASI_Hs01_00200177 predicted 785
3 SASI_Hs01_00200178 predicted 495
4 SASI_Hs01_00200179 predicted 690
5 SASI_Hs01_00200180 predicted 563
6 SASI_Hs01_00200181 predicted 464
7 SASI_Hs01_00200182 predicted 609
8 SASI_Hs01_00200183 predicted 490
9 SASI_Hs01_00200184 predicted 419
10 SASI_Hs01_00200185 predicted 626
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022180 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00099309 predicted 283
2 SASI_Rn01_00099310 predicted 705
3 SASI_Rn01_00099311 predicted 345
4 SASI_Rn01_00099312 predicted 1133
5 SASI_Rn01_00099313 predicted 852
6 SASI_Rn01_00099315 predicted 636
7 SASI_Rn01_00099316 predicted 960
8 SASI_Rn01_00099317 predicted 488
9 SASI_Rn01_00099318 predicted 542
10 SASI_Rn02_00262925 predicted 718
11 SASI_Rn01_00099314 predicted 1219
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008261 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00313479 predicted 381
2 SASI_Mm01_00122935 predicted 1581
3 SASI_Mm01_00122936 predicted 446
4 SASI_Mm01_00122937 predicted 719
5 SASI_Mm01_00122938 predicted 1309
6 SASI_Mm01_00122939 predicted 443
7 SASI_Mm01_00122940 predicted 1594
8 SASI_Mm01_00122941 predicted 951
9 SASI_Mm01_00122942 predicted 1519
10 SASI_Mm01_00122943 predicted 413
11 SASI_Mm01_00122944 predicted 1618
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000457
HNF4A MISSION shRNA Bacterial Glycerol Stock
hepatocyte nuclear factor 4, alpha
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000376470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000457.3-1262s21c1
Sequence:CCGGTCACCTGATGCAGGAACATATCTCGAGATATGTTCCTGCATCAGGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000457.3-1168s21c1
Sequence:CCGGTCTTCGGCATGGCCAAGATTGCTCGAGCAATCTTGGCCATGCCGAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000457.3-1054s21c1
Sequence:CCGGACATCAACGACCGCCAGTATGCTCGAGCATACTGGCGGTCGTTGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000457.3-1410s21c1
Sequence:CCGGTCAGGGTCTGAGCCCTATAAGCTCGAGCTTATAGGGCTCAGACCCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000457.3-1293s21c1
Sequence:CCGGGTCATCGTTGCCAACACAATGCTCGAGCATTGTGTTGGCAACGATGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000457.3-153s21c1
Sequence:CCGGGCCTACACCACCCTGGAATTTCTCGAGAAATTCCAGGGTGGTGTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000457.3-1491s21c1
Sequence:CCGGATCACCAAGCAGGAAGTTATCCTCGAGGATAACTTCCTGCTTGGTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364380    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000457.3-1689s21c1
Sequence:CCGGTTGACGCCCTGCTCTGGATAACTCGAGTTATCCAGAGCAGGGCGTCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364379    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000457.3-1837s21c1
Sequence:CCGGATGACTTGAGGCCTTACTTAACTCGAGTTAAGTAAGGCCTCAAGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000457.3-365s21c1
Sequence:CCGGCATGTACTCCTGCAGATTTAGCTCGAGCTAAATCTGCAGGAGTACATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000457.3-159s1c1
Sequence:CCGGACCACCCTGGAATTTGAGAATCTCGAGATTCTCAAATTCCAGGGTGGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000457.3-1145s1c1
Sequence:CCGGCGAGCAGATCCAGTTCATCAACTCGAGTTGATGAACTGGATCTGCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000457.3-1489s1c1
Sequence:CCGGCCATCACCAAGCAGGAAGTTACTCGAGTAACTTCCTGCTTGGTGATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000457.3-1271s1c1
Sequence:CCGGGCAGGAACATATGGGAACCAACTCGAGTTGGTTCCCATATGTTCCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000457.3-362s1c1
Sequence:CCGGCCACATGTACTCCTGCAGATTCTCGAGAATCTGCAGGAGTACATGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000457
HNF4A MISSION shRNA shRNA Plasmid DNA
hepatocyte nuclear factor 4, alpha
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000376470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000457.3-1262s21c1
Sequence:CCGGTCACCTGATGCAGGAACATATCTCGAGATATGTTCCTGCATCAGGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000457.3-1168s21c1
Sequence:CCGGTCTTCGGCATGGCCAAGATTGCTCGAGCAATCTTGGCCATGCCGAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000457.3-1054s21c1
Sequence:CCGGACATCAACGACCGCCAGTATGCTCGAGCATACTGGCGGTCGTTGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000457.3-1410s21c1
Sequence:CCGGTCAGGGTCTGAGCCCTATAAGCTCGAGCTTATAGGGCTCAGACCCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000457.3-1293s21c1
Sequence:CCGGGTCATCGTTGCCAACACAATGCTCGAGCATTGTGTTGGCAACGATGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000457.3-153s21c1
Sequence:CCGGGCCTACACCACCCTGGAATTTCTCGAGAAATTCCAGGGTGGTGTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000457.3-1491s21c1
Sequence:CCGGATCACCAAGCAGGAAGTTATCCTCGAGGATAACTTCCTGCTTGGTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364380    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000457.3-1689s21c1
Sequence:CCGGTTGACGCCCTGCTCTGGATAACTCGAGTTATCCAGAGCAGGGCGTCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364379    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000457.3-1837s21c1
Sequence:CCGGATGACTTGAGGCCTTACTTAACTCGAGTTAAGTAAGGCCTCAAGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000457.3-365s21c1
Sequence:CCGGCATGTACTCCTGCAGATTTAGCTCGAGCTAAATCTGCAGGAGTACATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000457.3-159s1c1
Sequence:CCGGACCACCCTGGAATTTGAGAATCTCGAGATTCTCAAATTCCAGGGTGGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000457.3-1145s1c1
Sequence:CCGGCGAGCAGATCCAGTTCATCAACTCGAGTTGATGAACTGGATCTGCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000457.3-1489s1c1
Sequence:CCGGCCATCACCAAGCAGGAAGTTACTCGAGTAACTTCCTGCTTGGTGATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000457.3-1271s1c1
Sequence:CCGGGCAGGAACATATGGGAACCAACTCGAGTTGGTTCCCATATGTTCCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000457.3-362s1c1
Sequence:CCGGCCACATGTACTCCTGCAGATTCTCGAGAATCTGCAGGAGTACATGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000457
HNF4A MISSION shRNA Lentiviral Transduction Particles
hepatocyte nuclear factor 4, alpha
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000376470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000457.3-1262s21c1
Sequence:CCGGTCACCTGATGCAGGAACATATCTCGAGATATGTTCCTGCATCAGGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000457.3-1168s21c1
Sequence:CCGGTCTTCGGCATGGCCAAGATTGCTCGAGCAATCTTGGCCATGCCGAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000457.3-1054s21c1
Sequence:CCGGACATCAACGACCGCCAGTATGCTCGAGCATACTGGCGGTCGTTGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000457.3-1410s21c1
Sequence:CCGGTCAGGGTCTGAGCCCTATAAGCTCGAGCTTATAGGGCTCAGACCCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000457.3-1293s21c1
Sequence:CCGGGTCATCGTTGCCAACACAATGCTCGAGCATTGTGTTGGCAACGATGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000457.3-153s21c1
Sequence:CCGGGCCTACACCACCCTGGAATTTCTCGAGAAATTCCAGGGTGGTGTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000457.3-1491s21c1
Sequence:CCGGATCACCAAGCAGGAAGTTATCCTCGAGGATAACTTCCTGCTTGGTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364380    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000457.3-1689s21c1
Sequence:CCGGTTGACGCCCTGCTCTGGATAACTCGAGTTATCCAGAGCAGGGCGTCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364379    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000457.3-1837s21c1
Sequence:CCGGATGACTTGAGGCCTTACTTAACTCGAGTTAAGTAAGGCCTCAAGTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000457.3-365s21c1
Sequence:CCGGCATGTACTCCTGCAGATTTAGCTCGAGCTAAATCTGCAGGAGTACATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000457.3-159s1c1
Sequence:CCGGACCACCCTGGAATTTGAGAATCTCGAGATTCTCAAATTCCAGGGTGGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000457.3-1145s1c1
Sequence:CCGGCGAGCAGATCCAGTTCATCAACTCGAGTTGATGAACTGGATCTGCTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000457.3-1489s1c1
Sequence:CCGGCCATCACCAAGCAGGAAGTTACTCGAGTAACTTCCTGCTTGGTGATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000457.3-1271s1c1
Sequence:CCGGGCAGGAACATATGGGAACCAACTCGAGTTGGTTCCCATATGTTCCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000457.3-362s1c1
Sequence:CCGGCCACATGTACTCCTGCAGATTCTCGAGAATCTGCAGGAGTACATGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008261
VALIDATED
HNF4A MISSION shRNA Bacterial Glycerol Stock
hepatocyte nuclear factor 4, alpha
Mouse
17 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000365822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008261.2-1062s21c1
Sequence:CCGGGCAAGTGAGCCTGGAGGATTACTCGAGTAATCCTCCAGGCTCACTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008261.2-450s21c1
Sequence:CCGGGTGTCGTTACTGCAGGCTTAACTCGAGTTAAGCCTGCAGTAACGACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008261.2-670s21c1
Sequence:CCGGACAGACGTGTGTGAGTCTATGCTCGAGCATAGACTCACACACGTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008261.2-1173s21c1
Sequence:CCGGCGAACAGATCCAGTTCATCAACTCGAGTTGATGAACTGGATCTGTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008261.2-258s21c1
Sequence:CCGGCCTCAATTCATCCAACAGCCTCTCGAGAGGCTGTTGGATGAATTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008261.2-954s21c1
Sequence:CCGGGCAGATTGATGACAATGAATACTCGAGTATTCATTGTCATCAATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008261.2-815s21c1
Sequence:CCGGCCAAGAGGTCCATGGTGTTTACTCGAGTAAACACCATGGACCTCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008261.2-1307s21c1
Sequence:CCGGACATGGGCACCAATGTCATTGCTCGAGCAATGACATTGGTGCCCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008261.2-416s21c1
Sequence:CCGGGACAATGTGTGGTAGACAAAGCTCGAGCTTTGTCTACCACACATTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008261.2-626s21c1
Sequence:CCGGCTGGGATCAATGGCGACATTCCTCGAGGAATGTCGCCATTGATCCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008261.2-393s21c1
Sequence:CCGGCATGTACTCCTGCAGGTTTAGCTCGAGCTAAACCTGCAGGAGTACATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008261.2-1438s21c1
Sequence:CCGGTCGGGATCTGAATCCTACAAGCTCGAGCTTGTAGGATTCAGATCCCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008261.2-1313s1c1
Sequence:CCGGGCACCAATGTCATTGTTGCTACTCGAGTAGCAACAATGACATTGGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008261.2-258s1c1
Sequence:CCGGCCTCAATTCATCCAACAGCCTCTCGAGAGGCTGTTGGATGAATTGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008261.2-415s1c1
Sequence:CCGGCGACAATGTGTGGTAGACAAACTCGAGTTTGTCTACCACACATTGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008261.2-1173s1c1
Sequence:CCGGCGAACAGATCCAGTTCATCAACTCGAGTTGATGAACTGGATCTGTTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008261.2-954s1c1
Sequence:CCGGGCAGATTGATGACAATGAATACTCGAGTATTCATTGTCATCAATCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008261
VALIDATED
HNF4A MISSION shRNA shRNA Plasmid DNA
hepatocyte nuclear factor 4, alpha
Mouse
17 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000365822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008261.2-1062s21c1
Sequence:CCGGGCAAGTGAGCCTGGAGGATTACTCGAGTAATCCTCCAGGCTCACTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008261.2-450s21c1
Sequence:CCGGGTGTCGTTACTGCAGGCTTAACTCGAGTTAAGCCTGCAGTAACGACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008261.2-670s21c1
Sequence:CCGGACAGACGTGTGTGAGTCTATGCTCGAGCATAGACTCACACACGTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008261.2-1173s21c1
Sequence:CCGGCGAACAGATCCAGTTCATCAACTCGAGTTGATGAACTGGATCTGTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008261.2-258s21c1
Sequence:CCGGCCTCAATTCATCCAACAGCCTCTCGAGAGGCTGTTGGATGAATTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008261.2-954s21c1
Sequence:CCGGGCAGATTGATGACAATGAATACTCGAGTATTCATTGTCATCAATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008261.2-815s21c1
Sequence:CCGGCCAAGAGGTCCATGGTGTTTACTCGAGTAAACACCATGGACCTCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008261.2-1307s21c1
Sequence:CCGGACATGGGCACCAATGTCATTGCTCGAGCAATGACATTGGTGCCCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008261.2-416s21c1
Sequence:CCGGGACAATGTGTGGTAGACAAAGCTCGAGCTTTGTCTACCACACATTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008261.2-626s21c1
Sequence:CCGGCTGGGATCAATGGCGACATTCCTCGAGGAATGTCGCCATTGATCCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008261.2-393s21c1
Sequence:CCGGCATGTACTCCTGCAGGTTTAGCTCGAGCTAAACCTGCAGGAGTACATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008261.2-1438s21c1
Sequence:CCGGTCGGGATCTGAATCCTACAAGCTCGAGCTTGTAGGATTCAGATCCCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008261.2-1313s1c1
Sequence:CCGGGCACCAATGTCATTGTTGCTACTCGAGTAGCAACAATGACATTGGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008261.2-258s1c1
Sequence:CCGGCCTCAATTCATCCAACAGCCTCTCGAGAGGCTGTTGGATGAATTGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008261.2-415s1c1
Sequence:CCGGCGACAATGTGTGGTAGACAAACTCGAGTTTGTCTACCACACATTGTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008261.2-1173s1c1
Sequence:CCGGCGAACAGATCCAGTTCATCAACTCGAGTTGATGAACTGGATCTGTTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008261.2-954s1c1
Sequence:CCGGGCAGATTGATGACAATGAATACTCGAGTATTCATTGTCATCAATCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008261
VALIDATED
HNF4A MISSION shRNA Lentiviral Transduction Particles
hepatocyte nuclear factor 4, alpha
Mouse
17 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000365822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008261.2-1062s21c1
Sequence:CCGGGCAAGTGAGCCTGGAGGATTACTCGAGTAATCCTCCAGGCTCACTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008261.2-450s21c1
Sequence:CCGGGTGTCGTTACTGCAGGCTTAACTCGAGTTAAGCCTGCAGTAACGACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008261.2-670s21c1
Sequence:CCGGACAGACGTGTGTGAGTCTATGCTCGAGCATAGACTCACACACGTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008261.2-1173s21c1
Sequence:CCGGCGAACAGATCCAGTTCATCAACTCGAGTTGATGAACTGGATCTGTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008261.2-258s21c1
Sequence:CCGGCCTCAATTCATCCAACAGCCTCTCGAGAGGCTGTTGGATGAATTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008261.2-954s21c1
Sequence:CCGGGCAGATTGATGACAATGAATACTCGAGTATTCATTGTCATCAATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008261.2-815s21c1
Sequence:CCGGCCAAGAGGTCCATGGTGTTTACTCGAGTAAACACCATGGACCTCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008261.2-1307s21c1
Sequence:CCGGACATGGGCACCAATGTCATTGCTCGAGCAATGACATTGGTGCCCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008261.2-416s21c1
Sequence:CCGGGACAATGTGTGGTAGACAAAGCTCGAGCTTTGTCTACCACACATTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008261.2-626s21c1
Sequence:CCGGCTGGGATCAATGGCGACATTCCTCGAGGAATGTCGCCATTGATCCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008261.2-393s21c1
Sequence:CCGGCATGTACTCCTGCAGGTTTAGCTCGAGCTAAACCTGCAGGAGTACATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008261.2-1438s21c1
Sequence:CCGGTCGGGATCTGAATCCTACAAGCTCGAGCTTGTAGGATTCAGATCCCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008261.2-1313s1c1
Sequence:CCGGGCACCAATGTCATTGTTGCTACTCGAGTAGCAACAATGACATTGGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008261.2-258s1c1
Sequence:CCGGCCTCAATTCATCCAACAGCCTCTCGAGAGGCTGTTGGATGAATTGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008261.2-415s1c1
Sequence:CCGGCGACAATGTGTGGTAGACAAACTCGAGTTTGTCTACCACACATTGTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008261.2-1173s1c1
Sequence:CCGGCGAACAGATCCAGTTCATCAACTCGAGTTGATGAACTGGATCTGTTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008261.2-954s1c1
Sequence:CCGGGCAGATTGATGACAATGAATACTCGAGTATTCATTGTCATCAATCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)