EMAIL THIS PAGE TO A FRIEND

HNF4G

hepatocyte nuclear factor 4, gamma

132 Gene Product Result for
Synonyms: NR2A2 NR2A3
UniProtKB ID: Q14541, Q7Z2V9, Q9UH81, Q9UIS6
Gene ID:
Mouse(30942) hepatocyte nuclear factor 4, gamma
Rat(365744) hepatocyte nuclear factor 4, gamma
Zebrafish(557104) hepatocyte nuclear factor 4, gamma
cow(404168) hepatocyte nuclear factor 4, gamma
Horse(100050783) hepatocyte nuclear factor 4, gamma
domestic cat(101082626) hepatocyte nuclear factor 4, gamma
dog(487005) hepatocyte nuclear factor 4, gamma
chicken(428364) hepatocyte nuclear factor 4, gamma
sheep(101109713) hepatocyte nuclear factor 4, gamma
domestic guinea pig(100735524) hepatocyte nuclear factor 4, gamma
naked mole-rat(101720621) hepatocyte nuclear factor 4, gamma
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013920 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013920 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013920 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004133 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004133 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004133 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU092251 MISSION® esiRNA esiRNA human HNF4G (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004133 Rosetta Predictions human pricing
NM_001108939 Rosetta Predictions rat pricing
NM_013920 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004133 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00234212 predicted 1174
2 SASI_Hs01_00234213 predicted 838
3 SASI_Hs01_00234214 predicted 921
4 SASI_Hs01_00234215 predicted 566
5 SASI_Hs01_00234216 predicted 828
6 SASI_Hs01_00234219 predicted 1456
7 SASI_Hs02_00336984 predicted 411
8 SASI_Hs01_00234220 predicted 667
9 SASI_Hs02_00336985 predicted 696
10 SASI_Hs02_00336986 predicted 1117
11 SASI_Hs01_00234211 predicted 590
12 SASI_Hs01_00234217 predicted 687
13 SASI_Hs01_00234218 predicted 543
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108939 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00243574 predicted 1158
2 SASI_Rn02_00243575 predicted 815
3 SASI_Rn02_00243576 predicted 808
4 SASI_Rn02_00243577 predicted 237
5 SASI_Rn02_00243578 predicted 782
6 SASI_Rn02_00243579 predicted 435
7 SASI_Rn02_00243580 predicted 902
8 SASI_Rn02_00243581 predicted 1346
9 SASI_Rn02_00243582 predicted 682
10 SASI_Rn02_00243583 predicted 736
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013920 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00196489 predicted 1446
2 SASI_Mm01_00196490 predicted 465
3 SASI_Mm01_00196491 predicted 413
4 SASI_Mm01_00196492 predicted 716
5 SASI_Mm01_00196493 predicted 1457
6 SASI_Mm01_00196494 predicted 1027
7 SASI_Mm01_00196495 predicted 1288
8 SASI_Mm01_00196496 predicted 684
9 SASI_Mm01_00196497 predicted 557
10 SASI_Mm01_00196498 predicted 1466
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013920
HNF4G MISSION shRNA Bacterial Glycerol Stock
hepatocyte nuclear factor 4, gamma
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026047    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013920.1-1519s1c1
Sequence:CCGGCCTTCTGAATAGCACTGCATACTCGAGTATGCAGTGCTATTCAGAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013920.1-957s1c1
Sequence:CCGGCCCTTCCAAGAGATCCAGATACTCGAGTATCTGGATCTCTTGGAAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013920.1-1266s1c1
Sequence:CCGGGCTGCCAATGATGGTAGTCATCTCGAGATGACTACCATCATTGGCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013920.1-538s1c1
Sequence:CCGGGCGACAGAATCAGTACAAGAACTCGAGTTCTTGTACTGATTCTGTCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013920.1-1046s1c1
Sequence:CCGGCCCTGTGAAGATTAAGAACATCTCGAGATGTTCTTAATCTTCACAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013920
HNF4G MISSION shRNA shRNA Plasmid DNA
hepatocyte nuclear factor 4, gamma
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026047    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013920.1-1519s1c1
Sequence:CCGGCCTTCTGAATAGCACTGCATACTCGAGTATGCAGTGCTATTCAGAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013920.1-957s1c1
Sequence:CCGGCCCTTCCAAGAGATCCAGATACTCGAGTATCTGGATCTCTTGGAAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013920.1-1266s1c1
Sequence:CCGGGCTGCCAATGATGGTAGTCATCTCGAGATGACTACCATCATTGGCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013920.1-538s1c1
Sequence:CCGGGCGACAGAATCAGTACAAGAACTCGAGTTCTTGTACTGATTCTGTCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013920.1-1046s1c1
Sequence:CCGGCCCTGTGAAGATTAAGAACATCTCGAGATGTTCTTAATCTTCACAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013920
HNF4G MISSION shRNA Lentiviral Transduction Particles
hepatocyte nuclear factor 4, gamma
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000026047    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013920.1-1519s1c1
Sequence:CCGGCCTTCTGAATAGCACTGCATACTCGAGTATGCAGTGCTATTCAGAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013920.1-957s1c1
Sequence:CCGGCCCTTCCAAGAGATCCAGATACTCGAGTATCTGGATCTCTTGGAAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013920.1-1266s1c1
Sequence:CCGGGCTGCCAATGATGGTAGTCATCTCGAGATGACTACCATCATTGGCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013920.1-538s1c1
Sequence:CCGGGCGACAGAATCAGTACAAGAACTCGAGTTCTTGTACTGATTCTGTCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013920.1-1046s1c1
Sequence:CCGGCCCTGTGAAGATTAAGAACATCTCGAGATGTTCTTAATCTTCACAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004133
HNF4G MISSION shRNA Bacterial Glycerol Stock
hepatocyte nuclear factor 4, gamma
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000019242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004133.3-393s1c1
Sequence:CCGGGTGACAGAATAAGCACCAGAACTCGAGTTCTGGTGCTTATTCTGTCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004133.3-1032s1c1
Sequence:CCGGCGTGGCAAATGATTGAGCAAACTCGAGTTTGCTCAATCATTTGCCACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004133.3-252s1c1
Sequence:CCGGGCATTCGTAAGAGTCACGTTTCTCGAGAAACGTGACTCTTACGAATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004133.3-821s1c1
Sequence:CCGGGAAATCCAGATTGATGACAATCTCGAGATTGTCATCAATCTGGATTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004133.3-1331s1c1
Sequence:CCGGCACCAGCATCTCTCCAAACAACTCGAGTTGTTTGGAGAGATGCTGGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004133.4-954s21c1
Sequence:CCGGACATCAATGATCGGCAGTATGCTCGAGCATACTGCCGATCATTGATGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004133.4-797s21c1
Sequence:CCAGGATGAGCTGGTTAGACCATTTCTCGAGAAATGGTCTAACCAGCTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004133
HNF4G MISSION shRNA shRNA Plasmid DNA
hepatocyte nuclear factor 4, gamma
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000019242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004133.3-393s1c1
Sequence:CCGGGTGACAGAATAAGCACCAGAACTCGAGTTCTGGTGCTTATTCTGTCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004133.3-1032s1c1
Sequence:CCGGCGTGGCAAATGATTGAGCAAACTCGAGTTTGCTCAATCATTTGCCACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004133.3-252s1c1
Sequence:CCGGGCATTCGTAAGAGTCACGTTTCTCGAGAAACGTGACTCTTACGAATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004133.3-821s1c1
Sequence:CCGGGAAATCCAGATTGATGACAATCTCGAGATTGTCATCAATCTGGATTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004133.3-1331s1c1
Sequence:CCGGCACCAGCATCTCTCCAAACAACTCGAGTTGTTTGGAGAGATGCTGGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004133.4-954s21c1
Sequence:CCGGACATCAATGATCGGCAGTATGCTCGAGCATACTGCCGATCATTGATGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004133.4-797s21c1
Sequence:CCAGGATGAGCTGGTTAGACCATTTCTCGAGAAATGGTCTAACCAGCTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004133
HNF4G MISSION shRNA Lentiviral Transduction Particles
hepatocyte nuclear factor 4, gamma
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000019242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004133.3-393s1c1
Sequence:CCGGGTGACAGAATAAGCACCAGAACTCGAGTTCTGGTGCTTATTCTGTCACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004133.3-1032s1c1
Sequence:CCGGCGTGGCAAATGATTGAGCAAACTCGAGTTTGCTCAATCATTTGCCACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004133.3-252s1c1
Sequence:CCGGGCATTCGTAAGAGTCACGTTTCTCGAGAAACGTGACTCTTACGAATGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004133.3-821s1c1
Sequence:CCGGGAAATCCAGATTGATGACAATCTCGAGATTGTCATCAATCTGGATTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004133.3-1331s1c1
Sequence:CCGGCACCAGCATCTCTCCAAACAACTCGAGTTGTTTGGAGAGATGCTGGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004133.4-954s21c1
Sequence:CCGGACATCAATGATCGGCAGTATGCTCGAGCATACTGCCGATCATTGATGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004133.4-797s21c1
Sequence:CCAGGATGAGCTGGTTAGACCATTTCTCGAGAAATGGTCTAACCAGCTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)