EMAIL THIS PAGE TO A FRIEND

HNRNPA0

heterogeneous nuclear ribonucleoprotein A0

141 Gene Product Result for
Synonyms: HNRPA0
UniProtKB ID: Q13151, Q6IB18
Gene ID:
Human(10949) Summary: This gene belongs to the A/B subfamily of ubiquitously expressed heterogeneous nuclear ribonucleoproteins (hnRNPs). The hnRNPs are RNA binding proteins and they complex with heterogeneous nuclear RNA (hnRNA). These proteins are associated with pre-mRNAs in the nucleus and appear to influence pre-mRNA processing and other aspects of mRNA metabolism and transport. While all of the hnRNPs are present in the nucleus, some seem to shuttle between the nucleus and the cytoplasm. The hnRNP proteins have distinct nucleic acid binding properties. The protein encoded by this gene has two repeats of quasi-RRM domains that bind RNAs, followed by a glycine-rich C-terminus. [provided by RefSeq, Jul 2008]
Mouse(77134) heterogeneous nuclear ribonucleoprotein A0
Rat(498696) heterogeneous nuclear ribonucleoprotein A0
chicken(416302) heterogeneous nuclear ribonucleoprotein A0
dog(481524) heterogeneous nuclear ribonucleoprotein A0
cow(540311) heterogeneous nuclear ribonucleoprotein A0
domestic cat(101088977) heterogeneous nuclear ribonucleoprotein A0
domestic guinea pig(100718042) heterogeneous nuclear ribonucleoprotein A0
naked mole-rat(101699501) heterogeneous nuclear ribonucleoprotein A0
sheep(101120328) heterogeneous nuclear ribonucleoprotein A0
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA036569 Anti-HNRNPA0 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation mouse, rat, human
immunofluorescence, immunohistochemistry, western blot pricing
HPA059404 Anti-HNRNPA0 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody Antibody Enhanced Validation human
immunofluorescence, immunohistochemistry, western blot pricing
AV40686 Anti-HNRPA0 antibody produced in rabbit IgG fraction of antiserum canine, human, bovine
immunofluorescence, immunohistochemistry, immunoprecipitation (IP), western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006805 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006805 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006805 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006805 Rosetta Predictions human pricing
XM_573981 Rosetta Predictions rat pricing
XM_001001311 Rosetta Predictions mouse pricing
XM_891442 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006805 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00149990 predicted 350
2 SASI_Hs01_00149988 predicted 405
3 SASI_Hs02_00342325 predicted 420
4 SASI_Hs01_00149991 predicted 1659
5 SASI_Hs01_00149992 predicted 635
6 SASI_Hs01_00149993 predicted 743
7 SASI_Hs01_00149994 predicted 1428
8 SASI_Hs01_00149995 predicted 695
9 SASI_Hs01_00149997 predicted 1355
10 SASI_Hs02_00342326 predicted 734
11 SASI_Hs01_00149989 predicted 1321
12 SASI_Hs01_00149996 predicted 1653
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573981 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00162345 predicted 490
2 SASI_Rn01_00162346 predicted 440
3 SASI_Rn01_00162347 predicted 2225
4 SASI_Rn01_00162348 predicted 500
5 SASI_Rn01_00162349 predicted 429
6 SASI_Rn01_00162350 predicted 2225
7 SASI_Rn01_00162351 predicted 405
8 SASI_Rn01_00162352 predicted 321
9 SASI_Rn01_00162353 predicted 2225
10 SASI_Rn01_00162354 predicted 407
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001001311 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00355074 predicted 320
2 SASI_Mm02_00355075 predicted 413
3 SASI_Mm02_00355076 predicted 262
4 SASI_Mm02_00355077 predicted 261
5 SASI_Mm02_00355078 predicted 257
6 SASI_Mm02_00355079 predicted 268
7 SASI_Mm02_00355080 predicted 360
8 SASI_Mm02_00355081 predicted 359
9 SASI_Mm02_00355082 predicted 266
10 SASI_Mm02_00355083 predicted 341
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_891442 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00268484 predicted 442
2 SASI_Mm01_00268485 predicted 535
3 SASI_Mm01_00268486 predicted 380
4 SASI_Mm01_00268487 predicted 1328
5 SASI_Mm01_00268488 predicted 369
6 SASI_Mm01_00268489 predicted 388
7 SASI_Mm01_00268490 predicted 484
8 SASI_Mm02_00429014 predicted 260
9 SASI_Mm01_00268492 predicted 1323
10 SASI_Mm01_00268493 predicted 1445
11 SASI_Mm01_00268491 predicted 1568
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006805
VALIDATED
HNRNPA0 MISSION shRNA Bacterial Glycerol Stock
heterogeneous nuclear ribonucleoprotein A0
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000017233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A3
TRC Version: 1 Clone ID:NM_006805.2-706s1c1
Sequence:CCGGCGGCTTCGTGTATTTCCAGAACTCGAGTTCTGGAAATACACGAAGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_006805.2-566s1c1
Sequence:CCGGGCCAAGGTTAAGAAGCTCTTTCTCGAGAAAGAGCTTCTTAACCTTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_006805.2-676s1c1
Sequence:CCGGCGACAAGCAGTCCGGCAAGAACTCGAGTTCTTGCCGGACTGCTTGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_006805.2-423s1c1
Sequence:CCGGCCCGTTGCTTTGGCTTCGTGACTCGAGTCACGAAGCCAAAGCAACGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_006805.2-1131s1c1
Sequence:CCGGGTCGCAGTAATAGTGGACCTTCTCGAGAAGGTCCACTATTACTGCGACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006805.3-707s21c1
Sequence:CCGGCGGCTTCGTGTATTTCCAGAACTCGAGTTCTGGAAATACACGAAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006805.3-567s21c1
Sequence:CCGGGCCAAGGTTAAGAAGCTCTTTCTCGAGAAAGAGCTTCTTAACCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006805.3-677s21c1
Sequence:CCGGCGACAAGCAGTCCGGCAAGAACTCGAGTTCTTGCCGGACTGCTTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006805.3-424s21c1
Sequence:CCGGCCCGTTGCTTTGGCTTCGTGACTCGAGTCACGAAGCCAAAGCAACGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006805
VALIDATED
HNRNPA0 MISSION shRNA shRNA Plasmid DNA
heterogeneous nuclear ribonucleoprotein A0
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000017233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A3
TRC Version: 1 Clone ID:NM_006805.2-706s1c1
Sequence:CCGGCGGCTTCGTGTATTTCCAGAACTCGAGTTCTGGAAATACACGAAGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_006805.2-566s1c1
Sequence:CCGGGCCAAGGTTAAGAAGCTCTTTCTCGAGAAAGAGCTTCTTAACCTTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_006805.2-676s1c1
Sequence:CCGGCGACAAGCAGTCCGGCAAGAACTCGAGTTCTTGCCGGACTGCTTGTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_006805.2-423s1c1
Sequence:CCGGCCCGTTGCTTTGGCTTCGTGACTCGAGTCACGAAGCCAAAGCAACGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_006805.2-1131s1c1
Sequence:CCGGGTCGCAGTAATAGTGGACCTTCTCGAGAAGGTCCACTATTACTGCGACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006805.3-707s21c1
Sequence:CCGGCGGCTTCGTGTATTTCCAGAACTCGAGTTCTGGAAATACACGAAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006805.3-567s21c1
Sequence:CCGGGCCAAGGTTAAGAAGCTCTTTCTCGAGAAAGAGCTTCTTAACCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006805.3-677s21c1
Sequence:CCGGCGACAAGCAGTCCGGCAAGAACTCGAGTTCTTGCCGGACTGCTTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006805.3-424s21c1
Sequence:CCGGCCCGTTGCTTTGGCTTCGTGACTCGAGTCACGAAGCCAAAGCAACGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006805
VALIDATED
HNRNPA0 MISSION shRNA Lentiviral Transduction Particles
heterogeneous nuclear ribonucleoprotein A0
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000017233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A3
TRC Version: 1 Clone ID:NM_006805.2-706s1c1
Sequence:CCGGCGGCTTCGTGTATTTCCAGAACTCGAGTTCTGGAAATACACGAAGCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_006805.2-566s1c1
Sequence:CCGGGCCAAGGTTAAGAAGCTCTTTCTCGAGAAAGAGCTTCTTAACCTTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_006805.2-676s1c1
Sequence:CCGGCGACAAGCAGTCCGGCAAGAACTCGAGTTCTTGCCGGACTGCTTGTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_006805.2-423s1c1
Sequence:CCGGCCCGTTGCTTTGGCTTCGTGACTCGAGTCACGAAGCCAAAGCAACGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_006805.2-1131s1c1
Sequence:CCGGGTCGCAGTAATAGTGGACCTTCTCGAGAAGGTCCACTATTACTGCGACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006805.3-707s21c1
Sequence:CCGGCGGCTTCGTGTATTTCCAGAACTCGAGTTCTGGAAATACACGAAGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006805.3-567s21c1
Sequence:CCGGGCCAAGGTTAAGAAGCTCTTTCTCGAGAAAGAGCTTCTTAACCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006805.3-677s21c1
Sequence:CCGGCGACAAGCAGTCCGGCAAGAACTCGAGTTCTTGCCGGACTGCTTGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006805.3-424s21c1
Sequence:CCGGCCCGTTGCTTTGGCTTCGTGACTCGAGTCACGAAGCCAAAGCAACGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)