EMAIL THIS PAGE TO A FRIEND

HNRNPA1

heterogeneous nuclear ribonucleoprotein A1

156 Gene Product Result for
Synonyms: HNRPA1 HNRPA1L3 hnRNP A1 hnRNP-A1
UniProtKB ID: P09651, A8K4Z8, Q3MIB7, Q6PJZ7
Gene ID:
Human(3178) Summary: This gene belongs to the A/B subfamily of ubiquitously expressed heterogeneous nuclear ribonucleoproteins (hnRNPs). The hnRNPs are RNA binding proteins and they complex with heterogeneous nuclear RNA (hnRNA). These proteins are associated with pre-mRNAs in the nucleus and appear to influence pre-mRNA processing and other aspects of mRNA metabolism and transport. While all of the hnRNPs are present in the nucleus, some seem to shuttle between the nucleus and the cytoplasm. The hnRNP proteins have distinct nucleic acid binding properties. The protein encoded by this gene has two repeats of quasi-RRM domains that bind to RNAs. It is one of the most abundant core proteins of hnRNP complexes and it is localized to the nucleoplasm. This protein, along with other hnRNP proteins, is exported from the nucleus, probably bound to mRNA, and is immediately re-imported. Its M9 domain acts as both a nuclear localization and nuclear export signal. The encoded protein is involved in the packaging of pre-mRNA into hnRNP particles, transport of poly A+ mRNA from the nucleus to the cytoplasm, and may modulate splice site selection. It is also thought have a primary role in the formation of specific myometrial protein species in parturition. Multiple alternatively spliced transcript variants have been found for this gene but only two transcripts are fully described. These variants have multiple alternative transcription initiation sites and multiple polyA sites. [provided by RefSeq, Jul 2008]
Mouse(15382) heterogeneous nuclear ribonucleoprotein A1
Rat(29578) heterogeneous nuclear ribonucleoprotein A1
Zebrafish(378453) heterogeneous nuclear ribonucleoprotein A1
Horse(100034153) heterogeneous nuclear ribonucleoprotein A1
domestic cat(101092031) heterogeneous nuclear ribonucleoprotein A1
cow(505093) heterogeneous nuclear ribonucleoprotein A1
domestic guinea pig(100726972) heterogeneous nuclear ribonucleoprotein A1
naked mole-rat(101711324) heterogeneous nuclear ribonucleoprotein A1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4300651 Anti-hnRNP A1 (Ab-192) antibody produced in rabbit affinity isolated antibody rat, mouse, human
western blot pricing
SAB4501416 Anti-HNRNP A1 antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
R4528 Anti-hnRNP-A1 antibody, Mouse monoclonal clone 9H10, purified from hybridoma cell culture canine, hamster, monkey, mouse, bovine, human, rat
immunocytochemistry, immunohistochemistry, immunoprecipitation (IP), microarray, western blot pricing
HPA001609 Anti-HNRNPA1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
HPA007185 Anti-HNRNPA1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence, western blot pricing
AV40383 Anti-HNRPA1 (AB1) antibody produced in rabbit IgG fraction of antiserum pig, rat, guinea pig, mouse, canine, human, horse, bovine, rabbit
immunohistochemistry, western blot pricing
AV40384 Anti-HNRPA1 (AB2) antibody produced in rabbit IgG fraction of antiserum horse, rat, rabbit, canine, human, guinea pig, bovine, mouse, pig
immunohistochemistry, western blot pricing
R9778 Monoclonal Anti-hnRNP-A1 antibody produced in mouse ~2 mg/mL, clone 4B10, purified immunoglobulin, buffered aqueous solution human, bovine, canine
ELISA, immunocytochemistry, immunoprecipitation (IP), microarray, western blot pricing
SAB1402226 Monoclonal Anti-HNRPA1 antibody produced in mouse clone 2E6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002136 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002136 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002136 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010447 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010447 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010447 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002136 Rosetta Predictions human pricing
NM_031157 Rosetta Predictions human pricing
NM_017248 Rosetta Predictions rat pricing
NM_001039129 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002136 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00333298 predicted 342
2 SASI_Hs02_00333299 predicted 233
3 SASI_Hs02_00333300 predicted 314
4 SASI_Hs02_00333301 predicted 370
5 SASI_Hs02_00333302 predicted 344
6 SASI_Hs02_00333303 predicted 300
7 SASI_Hs02_00333304 predicted 335
8 SASI_Hs02_00333305 predicted 144
9 SASI_Hs02_00333306 predicted 676
10 SASI_Hs02_00333307 predicted 151
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031157 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00358592 predicted 338
2 SASI_Hs02_00358593 predicted 232
3 SASI_Hs02_00358594 predicted 312
4 SASI_Hs02_00358595 predicted 365
5 SASI_Hs02_00358596 predicted 343
6 SASI_Hs02_00358597 predicted 301
7 SASI_Hs02_00358598 predicted 337
8 SASI_Hs02_00358599 predicted 143
9 SASI_Hs02_00358600 predicted 680
10 SASI_Hs02_00358601 predicted 148
11 SASI_Hs01_00105565 predicted 962
12 SASI_Hs01_00105566 predicted 932
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017248 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00261627 predicted 463
2 SASI_Rn02_00261628 predicted 379
3 SASI_Rn02_00261629 predicted 340
4 SASI_Rn02_00261630 predicted 342
5 SASI_Rn02_00261631 predicted 646
6 SASI_Rn02_00261632 predicted 265
7 SASI_Rn02_00261633 predicted 1048
8 SASI_Rn02_00261634 predicted 1037
9 SASI_Rn02_00261635 predicted 754
10 SASI_Rn02_00261636 predicted 1033
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039129 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00289837 predicted 423
2 SASI_Mm01_00149753 predicted 937
3 SASI_Mm02_00289838 predicted 118
4 SASI_Mm01_00149754 predicted 904
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002136
VALIDATED
HNRNPA1 MISSION shRNA Bacterial Glycerol Stock
heterogeneous nuclear ribonucleoprotein A1
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377199    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002136.2-1368s21c1
Sequence:CCGGGTCTGATCGTGACGCTGAATACTCGAGTATTCAGCGTCACGATCAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002136.2-421s21c1
Sequence:CCGGAGATATTTGTTGGTGGCATTACTCGAGTAATGCCACCAACAAATATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368906    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002136.2-1557s21c1
Sequence:CCGGTGTAGTTGAACTGATAGTTACCTCGAGGTAACTATCAGTTCAACTACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002136.2-832s21c1
Sequence:CCGGGCTATAATGGATTTGGTAATGCTCGAGCATTACCAAATCCATTATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235099    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002136.2-1584s21c1
Sequence:CCGGGACCTGAAGTTCACCATTAAACTCGAGTTTAATGGTGAACTTCAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_002136.2-926s21c1
Sequence:CCGGACCCATGAAGGGAGGAAATTTCTCGAGAAATTTCCTCCCTTCATGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_002136.2-902s21c1
Sequence:CCGGCAACAATCAGTCTTCAAATTTCTCGAGAAATTTGAAGACTGATTGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002136.2-566s21c1
Sequence:CCGGCGACCATGACTCCGTGGATAACTCGAGTTATCCACGGAGTCATGGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_002136.2-423s21c1
Sequence:CCGGATATTTGTTGGTGGCATTAAACTCGAGTTTAATGCCACCAACAAATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006582    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002136.1-1488s1c1
Sequence:CCGGGCCAGGTTCTATTTGGAATTTCTCGAGAAATTCCAAATAGAACCTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_002136.1-619s1c1
Sequence:CCGGGCCACAACTGTGAAGTTAGAACTCGAGTTCTAACTTCACAGTTGTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_002136.1-690s1c1
Sequence:CCGGCGAAGTGGTTCTGGAAACTTTCTCGAGAAAGTTTCCAGAACCACTTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_002136.1-421s1c1
Sequence:CCGGAGATATTTGTTGGTGGCATTACTCGAGTAATGCCACCAACAAATATCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_002136.1-233s1c1
Sequence:CCGGTGTGGTAATGAGAGATCCAAACTCGAGTTTGGATCTCTCATTACCACATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002136
VALIDATED
HNRNPA1 MISSION shRNA shRNA Plasmid DNA
heterogeneous nuclear ribonucleoprotein A1
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377199    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002136.2-1368s21c1
Sequence:CCGGGTCTGATCGTGACGCTGAATACTCGAGTATTCAGCGTCACGATCAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002136.2-421s21c1
Sequence:CCGGAGATATTTGTTGGTGGCATTACTCGAGTAATGCCACCAACAAATATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000368906    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002136.2-1557s21c1
Sequence:CCGGTGTAGTTGAACTGATAGTTACCTCGAGGTAACTATCAGTTCAACTACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000368907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002136.2-832s21c1
Sequence:CCGGGCTATAATGGATTTGGTAATGCTCGAGCATTACCAAATCCATTATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235099    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002136.2-1584s21c1
Sequence:CCGGGACCTGAAGTTCACCATTAAACTCGAGTTTAATGGTGAACTTCAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_002136.2-926s21c1
Sequence:CCGGACCCATGAAGGGAGGAAATTTCTCGAGAAATTTCCTCCCTTCATGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_002136.2-902s21c1
Sequence:CCGGCAACAATCAGTCTTCAAATTTCTCGAGAAATTTGAAGACTGATTGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002136.2-566s21c1
Sequence:CCGGCGACCATGACTCCGTGGATAACTCGAGTTATCCACGGAGTCATGGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_002136.2-423s21c1
Sequence:CCGGATATTTGTTGGTGGCATTAAACTCGAGTTTAATGCCACCAACAAATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006582    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002136.1-1488s1c1
Sequence:CCGGGCCAGGTTCTATTTGGAATTTCTCGAGAAATTCCAAATAGAACCTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_002136.1-619s1c1
Sequence:CCGGGCCACAACTGTGAAGTTAGAACTCGAGTTCTAACTTCACAGTTGTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_002136.1-690s1c1
Sequence:CCGGCGAAGTGGTTCTGGAAACTTTCTCGAGAAAGTTTCCAGAACCACTTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_002136.1-421s1c1
Sequence:CCGGAGATATTTGTTGGTGGCATTACTCGAGTAATGCCACCAACAAATATCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_002136.1-233s1c1
Sequence:CCGGTGTGGTAATGAGAGATCCAAACTCGAGTTTGGATCTCTCATTACCACATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002136
VALIDATED
HNRNPA1 MISSION shRNA Lentiviral Transduction Particles
heterogeneous nuclear ribonucleoprotein A1
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377199    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002136.2-1368s21c1
Sequence:CCGGGTCTGATCGTGACGCTGAATACTCGAGTATTCAGCGTCACGATCAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002136.2-421s21c1
Sequence:CCGGAGATATTTGTTGGTGGCATTACTCGAGTAATGCCACCAACAAATATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368906    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002136.2-1557s21c1
Sequence:CCGGTGTAGTTGAACTGATAGTTACCTCGAGGTAACTATCAGTTCAACTACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002136.2-832s21c1
Sequence:CCGGGCTATAATGGATTTGGTAATGCTCGAGCATTACCAAATCCATTATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235099    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002136.2-1584s21c1
Sequence:CCGGGACCTGAAGTTCACCATTAAACTCGAGTTTAATGGTGAACTTCAGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_002136.2-926s21c1
Sequence:CCGGACCCATGAAGGGAGGAAATTTCTCGAGAAATTTCCTCCCTTCATGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_002136.2-902s21c1
Sequence:CCGGCAACAATCAGTCTTCAAATTTCTCGAGAAATTTGAAGACTGATTGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002136.2-566s21c1
Sequence:CCGGCGACCATGACTCCGTGGATAACTCGAGTTATCCACGGAGTCATGGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_002136.2-423s21c1
Sequence:CCGGATATTTGTTGGTGGCATTAAACTCGAGTTTAATGCCACCAACAAATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006582    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002136.1-1488s1c1
Sequence:CCGGGCCAGGTTCTATTTGGAATTTCTCGAGAAATTCCAAATAGAACCTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_002136.1-619s1c1
Sequence:CCGGGCCACAACTGTGAAGTTAGAACTCGAGTTCTAACTTCACAGTTGTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_002136.1-690s1c1
Sequence:CCGGCGAAGTGGTTCTGGAAACTTTCTCGAGAAAGTTTCCAGAACCACTTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_002136.1-421s1c1
Sequence:CCGGAGATATTTGTTGGTGGCATTACTCGAGTAATGCCACCAACAAATATCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_002136.1-233s1c1
Sequence:CCGGTGTGGTAATGAGAGATCCAAACTCGAGTTTGGATCTCTCATTACCACATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010447
VALIDATED
HNRNPA1 MISSION shRNA Bacterial Glycerol Stock
heterogeneous nuclear ribonucleoprotein A1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000313583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010447.4-400s21c1
Sequence:CCGGGATCTTTGTTGGTGGTATTAACTCGAGTTAATACCACCAACAAAGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313631    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010447.4-1220s21c1
Sequence:CCGGGACTGTATTTGTGACTAATTGCTCGAGCAATTAGTCACAAATACAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010447.4-436s21c1
Sequence:CCGGACATCACCTACGAGATTATTTCTCGAGAAATAATCTCGTAGGTGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010447.4-549s21c1
Sequence:CCGGATGACTCTGTGGATAAGATTGCTCGAGCAATCTTATCCACAGAGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010447.4-668s21c1
Sequence:CCGGCGCAGTGGTTCTGGAAACTTTCTCGAGAAAGTTTCCAGAACCACTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055263    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010447.1-1503s1c1
Sequence:CCGGGCCAGTTACTATTGTAACTTTCTCGAGAAAGTTACAATAGTAACTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010447.1-373s1c1
Sequence:CCGGGAAGAACATCACCTACGAGATCTCGAGATCTCGTAGGTGATGTTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010447.1-539s1c1
Sequence:CCGGGCCACAACTGTGAAGTAAGAACTCGAGTTCTTACTTCACAGTTGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010447.1-815s1c1
Sequence:CCGGGCAATTACAACAATCAGTCTTCTCGAGAAGACTGATTGTTGTAATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010447.1-610s1c1
Sequence:CCGGCGCAGTGGTTCTGGAAACTTTCTCGAGAAAGTTTCCAGAACCACTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010447
VALIDATED
HNRNPA1 MISSION shRNA shRNA Plasmid DNA
heterogeneous nuclear ribonucleoprotein A1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000313583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010447.4-400s21c1
Sequence:CCGGGATCTTTGTTGGTGGTATTAACTCGAGTTAATACCACCAACAAAGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313631    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010447.4-1220s21c1
Sequence:CCGGGACTGTATTTGTGACTAATTGCTCGAGCAATTAGTCACAAATACAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010447.4-436s21c1
Sequence:CCGGACATCACCTACGAGATTATTTCTCGAGAAATAATCTCGTAGGTGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010447.4-549s21c1
Sequence:CCGGATGACTCTGTGGATAAGATTGCTCGAGCAATCTTATCCACAGAGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010447.4-668s21c1
Sequence:CCGGCGCAGTGGTTCTGGAAACTTTCTCGAGAAAGTTTCCAGAACCACTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055263    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010447.1-1503s1c1
Sequence:CCGGGCCAGTTACTATTGTAACTTTCTCGAGAAAGTTACAATAGTAACTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010447.1-373s1c1
Sequence:CCGGGAAGAACATCACCTACGAGATCTCGAGATCTCGTAGGTGATGTTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010447.1-539s1c1
Sequence:CCGGGCCACAACTGTGAAGTAAGAACTCGAGTTCTTACTTCACAGTTGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010447.1-815s1c1
Sequence:CCGGGCAATTACAACAATCAGTCTTCTCGAGAAGACTGATTGTTGTAATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010447.1-610s1c1
Sequence:CCGGCGCAGTGGTTCTGGAAACTTTCTCGAGAAAGTTTCCAGAACCACTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010447
VALIDATED
HNRNPA1 MISSION shRNA Lentiviral Transduction Particles
heterogeneous nuclear ribonucleoprotein A1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000313583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010447.4-400s21c1
Sequence:CCGGGATCTTTGTTGGTGGTATTAACTCGAGTTAATACCACCAACAAAGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313631    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010447.4-1220s21c1
Sequence:CCGGGACTGTATTTGTGACTAATTGCTCGAGCAATTAGTCACAAATACAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010447.4-436s21c1
Sequence:CCGGACATCACCTACGAGATTATTTCTCGAGAAATAATCTCGTAGGTGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010447.4-549s21c1
Sequence:CCGGATGACTCTGTGGATAAGATTGCTCGAGCAATCTTATCCACAGAGTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010447.4-668s21c1
Sequence:CCGGCGCAGTGGTTCTGGAAACTTTCTCGAGAAAGTTTCCAGAACCACTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055263    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010447.1-1503s1c1
Sequence:CCGGGCCAGTTACTATTGTAACTTTCTCGAGAAAGTTACAATAGTAACTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010447.1-373s1c1
Sequence:CCGGGAAGAACATCACCTACGAGATCTCGAGATCTCGTAGGTGATGTTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010447.1-539s1c1
Sequence:CCGGGCCACAACTGTGAAGTAAGAACTCGAGTTCTTACTTCACAGTTGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010447.1-815s1c1
Sequence:CCGGGCAATTACAACAATCAGTCTTCTCGAGAAGACTGATTGTTGTAATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010447.1-610s1c1
Sequence:CCGGCGCAGTGGTTCTGGAAACTTTCTCGAGAAAGTTTCCAGAACCACTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)