EMAIL THIS PAGE TO A FRIEND

HNRNPA1L2

heterogeneous nuclear ribonucleoprotein A1-like 2

10 Gene Product Result for
UniProtKB ID: Q32P51, Q5TBS2
Gene ID:
dog(477592) heterogeneous nuclear ribonucleoprotein A1-like
cow(785761) heterogeneous nuclear ribonucleoprotein A1-like 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV40283 Anti-RP11-78J21.1 (AB1) antibody produced in rabbit affinity isolated antibody bovine, dog, rabbit, horse, mouse, human, rat, pig
immunohistochemistry, western blot pricing
AV40282 Anti-RP11-78J21.1 (AB2) antibody produced in rabbit IgG fraction of antiserum rabbit, rat, dog, human, mouse
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001011725 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001011725 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001011725 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU116881 MISSION® esiRNA esiRNA human AL137058.8-201 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001011724 Rosetta Predictions human pricing
NM_001011725 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011724 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00132909 predicted 1284
2 SASI_Hs02_00306040 predicted 1572
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011725 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00192718 predicted 1141
2 SASI_Hs02_00306041 predicted 1430
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001011725
HNRNPA1L2 MISSION shRNA Bacterial Glycerol Stock
heterogeneous nuclear ribonucleoprotein A1-like 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000241555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001011725.1-1700s21c1
Sequence:CCGGTGGTGGAAGCTACAATGATTTCTCGAGAAATCATTGTAGCTTCCACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001011725.1-1250s21c1
Sequence:CCGGGATATTTGTTGGTGGCATTAACTCGAGTTAATGCCACCAACAAATATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011725.1-997s1c1
Sequence:CCGGGCTTTGAAACAACTGATGAGACTCGAGTCTCATCAGTTGTTTCAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001011725.1-1399s21c1
Sequence:CCGGATGACTCCGTGGATAAGATTGCTCGAGCAATCTTATCCACGGAGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001011725.1-1132s21c1
Sequence:CCGGAGGTGGATGCAGCTATGAATACTCGAGTATTCATAGCTGCATCCACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148048    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001011725.1-2059s1c1
Sequence:CCGGGAGGACTGTATTTGTGACTAACTCGAGTTAGTCACAAATACAGTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147566    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001011725.1-1946s1c1
Sequence:CCGGGCTACAGGTTACAACAGATTTCTCGAGAAATCTGTTGTAACCTGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241552    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001011725.1-1946s21c1
Sequence:CCGGGCTACAGGTTACAACAGATTTCTCGAGAAATCTGTTGTAACCTGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001011725
HNRNPA1L2 MISSION shRNA shRNA Plasmid DNA
heterogeneous nuclear ribonucleoprotein A1-like 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000241555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001011725.1-1700s21c1
Sequence:CCGGTGGTGGAAGCTACAATGATTTCTCGAGAAATCATTGTAGCTTCCACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001011725.1-1250s21c1
Sequence:CCGGGATATTTGTTGGTGGCATTAACTCGAGTTAATGCCACCAACAAATATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011725.1-997s1c1
Sequence:CCGGGCTTTGAAACAACTGATGAGACTCGAGTCTCATCAGTTGTTTCAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001011725.1-1399s21c1
Sequence:CCGGATGACTCCGTGGATAAGATTGCTCGAGCAATCTTATCCACGGAGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001011725.1-1132s21c1
Sequence:CCGGAGGTGGATGCAGCTATGAATACTCGAGTATTCATAGCTGCATCCACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148048    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001011725.1-2059s1c1
Sequence:CCGGGAGGACTGTATTTGTGACTAACTCGAGTTAGTCACAAATACAGTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147566    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001011725.1-1946s1c1
Sequence:CCGGGCTACAGGTTACAACAGATTTCTCGAGAAATCTGTTGTAACCTGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241552    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001011725.1-1946s21c1
Sequence:CCGGGCTACAGGTTACAACAGATTTCTCGAGAAATCTGTTGTAACCTGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001011725
HNRNPA1L2 MISSION shRNA Lentiviral Transduction Particles
heterogeneous nuclear ribonucleoprotein A1-like 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000241555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001011725.1-1700s21c1
Sequence:CCGGTGGTGGAAGCTACAATGATTTCTCGAGAAATCATTGTAGCTTCCACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001011725.1-1250s21c1
Sequence:CCGGGATATTTGTTGGTGGCATTAACTCGAGTTAATGCCACCAACAAATATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011725.1-997s1c1
Sequence:CCGGGCTTTGAAACAACTGATGAGACTCGAGTCTCATCAGTTGTTTCAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001011725.1-1399s21c1
Sequence:CCGGATGACTCCGTGGATAAGATTGCTCGAGCAATCTTATCCACGGAGTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001011725.1-1132s21c1
Sequence:CCGGAGGTGGATGCAGCTATGAATACTCGAGTATTCATAGCTGCATCCACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148048    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001011725.1-2059s1c1
Sequence:CCGGGAGGACTGTATTTGTGACTAACTCGAGTTAGTCACAAATACAGTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147566    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001011725.1-1946s1c1
Sequence:CCGGGCTACAGGTTACAACAGATTTCTCGAGAAATCTGTTGTAACCTGTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241552    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001011725.1-1946s21c1
Sequence:CCGGGCTACAGGTTACAACAGATTTCTCGAGAAATCTGTTGTAACCTGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)