EMAIL THIS PAGE TO A FRIEND

HNRNPA1P35

heterogeneous nuclear ribonucleoprotein A1 pseudogene 35

3 Gene Product Result for
Species: Human HNRNPA1P35(645691)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_001724174 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_001724174 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_001724174 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001724174 Rosetta Predictions human pricing
XM_928701 Rosetta Predictions human pricing
XM_936790 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001724174 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00459946 predicted 274
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_928701 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00480938 predicted 280
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_936790 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00482280 predicted 276
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_001724174
HNRNPA1P35 MISSION shRNA Bacterial Glycerol Stock
heterogeneous nuclear ribonucleoprotein A1 pseudogene 35
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000240126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001724174.1-891s21c1
Sequence:CCGGACCCGTGAAGGGAGGAAATTTCTCGAGAAATTTCCTCCCTTCACGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001724174.1-235s21c1
Sequence:CCGGGGCTTTGGGTTTGTCACATATCTCGAGATATGTGACAAACCCAAAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001724174.1-796s21c1
Sequence:CCGGGGCTATAATGGATTTGGTAATCTCGAGATTACCAAATCCATTATAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240128    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001724174.1-1122s21c1
Sequence:CCGGGACTGTATTTGTGACTAATTGCTCGAGCAATTAGTCACAAATACAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001724174.1-531s21c1
Sequence:CCGGTGACCATGACTCCGTGGATAACTCGAGTTATCCACGGAGTCATGGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_001724174
HNRNPA1P35 MISSION shRNA shRNA Plasmid DNA
heterogeneous nuclear ribonucleoprotein A1 pseudogene 35
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000240126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001724174.1-891s21c1
Sequence:CCGGACCCGTGAAGGGAGGAAATTTCTCGAGAAATTTCCTCCCTTCACGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001724174.1-235s21c1
Sequence:CCGGGGCTTTGGGTTTGTCACATATCTCGAGATATGTGACAAACCCAAAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001724174.1-796s21c1
Sequence:CCGGGGCTATAATGGATTTGGTAATCTCGAGATTACCAAATCCATTATAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240128    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001724174.1-1122s21c1
Sequence:CCGGGACTGTATTTGTGACTAATTGCTCGAGCAATTAGTCACAAATACAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001724174.1-531s21c1
Sequence:CCGGTGACCATGACTCCGTGGATAACTCGAGTTATCCACGGAGTCATGGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_001724174
HNRNPA1P35 MISSION shRNA Lentiviral Transduction Particles
heterogeneous nuclear ribonucleoprotein A1 pseudogene 35
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000240126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001724174.1-891s21c1
Sequence:CCGGACCCGTGAAGGGAGGAAATTTCTCGAGAAATTTCCTCCCTTCACGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001724174.1-235s21c1
Sequence:CCGGGGCTTTGGGTTTGTCACATATCTCGAGATATGTGACAAACCCAAAGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001724174.1-796s21c1
Sequence:CCGGGGCTATAATGGATTTGGTAATCTCGAGATTACCAAATCCATTATAGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240128    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001724174.1-1122s21c1
Sequence:CCGGGACTGTATTTGTGACTAATTGCTCGAGCAATTAGTCACAAATACAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001724174.1-531s21c1
Sequence:CCGGTGACCATGACTCCGTGGATAACTCGAGTTATCCACGGAGTCATGGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)