EMAIL THIS PAGE TO A FRIEND

HNRNPA1P60

heterogeneous nuclear ribonucleoprotein A1 pseudogene 60

13 Gene Product Result for
Species: Human HNRNPA1P60(120364)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_001718684 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_001718684 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_001718684 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001718684 Rosetta Predictions human pricing
XM_062025 Rosetta Predictions human pricing
XM_937967 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001718684 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00425616 predicted 552
2 SASI_Hs02_00425617 predicted 660
3 SASI_Hs02_00425618 predicted 722
4 SASI_Hs02_00425619 predicted 720
5 SASI_Hs02_00425620 predicted 62
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_062025 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00478728 predicted 554
2 SASI_Hs02_00478729 predicted 724
3 SASI_Hs02_00478730 predicted 720
4 SASI_Hs02_00478731 predicted 60
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_937967 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00482790 predicted 557
2 SASI_Hs02_00482791 predicted 719
3 SASI_Hs02_00482792 predicted 719
4 SASI_Hs02_00482793 predicted 57
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_001718684
VALIDATED
HNRNPA1P60 MISSION shRNA Bacterial Glycerol Stock
heterogeneous nuclear ribonucleoprotein A1 pseudogene 60
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000236628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001718684.1-437s21c1
Sequence:CCGGGGGACTTTGCCTTTGTAACTTCTCGAGAAGTTACAAAGGCAAAGTCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001718684.1-462s21c1
Sequence:CCGGCAACCATGACTCCACGGATAACTCGAGTTATCCGTGGAGTCATGGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:XM_001718684.1-290s21c1
Sequence:CCGGGACCAGGTGCCTACTTAACAGCTCGAGCTGTTAAGTAGGCACCTGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001718684.1-700s21c1
Sequence:CCGGGGCAGTGCAGACGGCTATAATCTCGAGATTATAGCCGTCTGCACTGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_001718684
VALIDATED
HNRNPA1P60 MISSION shRNA shRNA Plasmid DNA
heterogeneous nuclear ribonucleoprotein A1 pseudogene 60
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000236628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001718684.1-437s21c1
Sequence:CCGGGGGACTTTGCCTTTGTAACTTCTCGAGAAGTTACAAAGGCAAAGTCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001718684.1-462s21c1
Sequence:CCGGCAACCATGACTCCACGGATAACTCGAGTTATCCGTGGAGTCATGGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:XM_001718684.1-290s21c1
Sequence:CCGGGACCAGGTGCCTACTTAACAGCTCGAGCTGTTAAGTAGGCACCTGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001718684.1-700s21c1
Sequence:CCGGGGCAGTGCAGACGGCTATAATCTCGAGATTATAGCCGTCTGCACTGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_001718684
VALIDATED
HNRNPA1P60 MISSION shRNA Lentiviral Transduction Particles
heterogeneous nuclear ribonucleoprotein A1 pseudogene 60
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000236628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001718684.1-437s21c1
Sequence:CCGGGGGACTTTGCCTTTGTAACTTCTCGAGAAGTTACAAAGGCAAAGTCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001718684.1-462s21c1
Sequence:CCGGCAACCATGACTCCACGGATAACTCGAGTTATCCGTGGAGTCATGGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:XM_001718684.1-290s21c1
Sequence:CCGGGACCAGGTGCCTACTTAACAGCTCGAGCTGTTAAGTAGGCACCTGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001718684.1-700s21c1
Sequence:CCGGGGCAGTGCAGACGGCTATAATCTCGAGATTATAGCCGTCTGCACTGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)