EMAIL THIS PAGE TO A FRIEND

HNRNPA3

heterogeneous nuclear ribonucleoprotein A3

327 Gene Product Result for
Synonyms: 2610510D13Rik D10S102 FBRNP HNRPA3
UniProtKB ID: P51991, D3DPF4, Q53RW7, Q6URK5
Gene ID:
Mouse(229279) heterogeneous nuclear ribonucleoprotein A3
Rat(362152) heterogeneous nuclear ribonucleoprotein A3
domestic guinea pig(100735598) heterogeneous nuclear ribonucleoprotein A3
naked mole-rat(101697298) heterogeneous nuclear ribonucleoprotein A3
sheep(101105552) heterogeneous nuclear ribonucleoprotein A3
Zebrafish(751729) heterogeneous nuclear ribonucleoprotein A3
chicken(424136) heterogeneous nuclear ribonucleoprotein A3
domestic cat(101098397) heterogeneous nuclear ribonucleoprotein A3
cow(782669) heterogeneous nuclear ribonucleoprotein A3
dog(608074) heterogeneous nuclear ribonucleoprotein A3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA066381 Anti-HNRNPA3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence, western blot pricing
SAB1305811 ANTI-HNRNPA3(N-TERMINAL) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing
AV41195 Anti-HNRPA3 (AB1) antibody produced in rabbit IgG fraction of antiserum, lyophilized powder canine, rat, mouse, human, bovine, rabbit
immunohistochemistry, western blot pricing
AV41196 Anti-HNRPA3 (AB2) antibody produced in rabbit IgG fraction of antiserum horse, guinea pig, bovine, rat, human, canine, mouse, rabbit
immunohistochemistry, western blot pricing
SAB2107990 Anti-HNRPA3 antibody produced in rabbit IgG fraction of antiserum bovine, guinea pig, mouse, canine, rabbit, human, rat
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198090 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198090 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198090 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_194247 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_194247 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_194247 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_194247 Rosetta Predictions human pricing
NM_001111294 Rosetta Predictions rat pricing
NM_001111295 Rosetta Predictions rat pricing
NM_198132 Rosetta Predictions rat pricing
NM_053263 Rosetta Predictions mouse pricing
NM_146130 Rosetta Predictions mouse pricing
NM_198090 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_194247 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00371362 predicted 375
2 SASI_Hs02_00371363 predicted 1492
3 SASI_Hs01_00231019 predicted 348
4 SASI_Hs01_00231020 predicted 344
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001111294 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00251542 predicted 758
2 SASI_Rn02_00251543 predicted 621
3 SASI_Rn02_00251544 predicted 644
4 SASI_Rn02_00251545 predicted 634
5 SASI_Rn02_00251546 predicted 628
6 SASI_Rn02_00251547 predicted 1193
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001111295 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00251548 predicted 558
2 SASI_Rn02_00251549 predicted 571
3 SASI_Rn02_00251550 predicted 698
4 SASI_Rn02_00251551 predicted 1028
5 SASI_Rn02_00251552 predicted 1035
6 SASI_Rn02_00251553 predicted 571
7 SASI_Rn02_00251554 predicted 558
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198132 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00269913 predicted 763
2 SASI_Rn02_00269914 predicted 623
3 SASI_Rn02_00269915 predicted 644
4 SASI_Rn02_00269916 predicted 631
5 SASI_Rn02_00269917 predicted 631
6 SASI_Rn01_00032344 predicted 1310
7 SASI_Rn01_00032345 predicted 1292
8 SASI_Rn01_00032346 predicted 1290
9 SASI_Rn01_00032347 predicted 1269
10 SASI_Rn01_00032348 predicted 1305
11 SASI_Rn01_00032349 predicted 1142
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053263 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00337896 predicted 514
2 SASI_Mm02_00337897 predicted 640
3 SASI_Mm02_00337898 predicted 306
4 SASI_Mm02_00337899 predicted 880
5 SASI_Mm02_00337900 predicted 310
6 SASI_Mm02_00337901 predicted 644
7 SASI_Mm02_00337902 predicted 542
8 SASI_Mm02_00337903 predicted 605
9 SASI_Mm02_00337904 predicted 568
10 SASI_Mm02_00337905 predicted 540
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146130 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00071770 predicted 583
2 SASI_Mm01_00071772 predicted 705
3 SASI_Mm02_00341805 predicted 377
4 SASI_Mm02_00341806 predicted 944
5 SASI_Mm02_00341807 predicted 370
6 SASI_Mm02_00341808 predicted 706
7 SASI_Mm02_00341809 predicted 602
8 SASI_Mm02_00341810 predicted 671
9 SASI_Mm02_00341811 predicted 630
10 SASI_Mm01_00071771 predicted 600
11 SASI_Mm01_00071765 predicted 246
12 SASI_Mm01_00071766 predicted 251
13 SASI_Mm01_00071767 predicted 357
14 SASI_Mm01_00071768 predicted 632
15 SASI_Mm01_00071769 predicted 648
16 SASI_Mm01_00071773 predicted 698
17 SASI_Mm01_00071774 predicted 815
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198090 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00350803 predicted 1448
2 SASI_Mm02_00350804 predicted 1459
3 SASI_Mm02_00350805 predicted 1481
4 SASI_Mm02_00350806 predicted 580
5 SASI_Mm02_00350807 predicted 372
6 SASI_Mm02_00350808 predicted 948
7 SASI_Mm02_00350809 predicted 1476
8 SASI_Mm02_00350810 predicted 605
9 SASI_Mm02_00350811 predicted 1488
10 SASI_Mm02_00350812 predicted 1453
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198090
VALIDATED
HNRNPA3 MISSION shRNA Bacterial Glycerol Stock
heterogeneous nuclear ribonucleoprotein A3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000112090    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_198090.1-1771s1c1
Sequence:CCGGGCCTGTATGATAACTCAAGTTCTCGAGAACTTGAGTTATCATACAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_198090.1-401s1c1
Sequence:CCGGTGCCCATTTAACGGTGAAGAACTCGAGTTCTTCACCGTTAAATGGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_198090.1-169s1c1
Sequence:CCGGGCTTTGAAACCACAGATGATACTCGAGTATCATCTGTGGTTTCAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_198090.1-976s1c1
Sequence:CCGGGTTACAATGAAGGAGGAAATTCTCGAGAATTTCCTCCTTCATTGTAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_198090.1-402s1c1
Sequence:CCGGGCCCATTTAACGGTGAAGAAACTCGAGTTTCTTCACCGTTAAATGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198090
VALIDATED
HNRNPA3 MISSION shRNA shRNA Plasmid DNA
heterogeneous nuclear ribonucleoprotein A3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000112090    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_198090.1-1771s1c1
Sequence:CCGGGCCTGTATGATAACTCAAGTTCTCGAGAACTTGAGTTATCATACAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_198090.1-401s1c1
Sequence:CCGGTGCCCATTTAACGGTGAAGAACTCGAGTTCTTCACCGTTAAATGGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_198090.1-169s1c1
Sequence:CCGGGCTTTGAAACCACAGATGATACTCGAGTATCATCTGTGGTTTCAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_198090.1-976s1c1
Sequence:CCGGGTTACAATGAAGGAGGAAATTCTCGAGAATTTCCTCCTTCATTGTAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_198090.1-402s1c1
Sequence:CCGGGCCCATTTAACGGTGAAGAAACTCGAGTTTCTTCACCGTTAAATGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198090
VALIDATED
HNRNPA3 MISSION shRNA Lentiviral Transduction Particles
heterogeneous nuclear ribonucleoprotein A3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000112090    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_198090.1-1771s1c1
Sequence:CCGGGCCTGTATGATAACTCAAGTTCTCGAGAACTTGAGTTATCATACAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_198090.1-401s1c1
Sequence:CCGGTGCCCATTTAACGGTGAAGAACTCGAGTTCTTCACCGTTAAATGGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_198090.1-169s1c1
Sequence:CCGGGCTTTGAAACCACAGATGATACTCGAGTATCATCTGTGGTTTCAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_198090.1-976s1c1
Sequence:CCGGGTTACAATGAAGGAGGAAATTCTCGAGAATTTCCTCCTTCATTGTAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_198090.1-402s1c1
Sequence:CCGGGCCCATTTAACGGTGAAGAAACTCGAGTTTCTTCACCGTTAAATGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_194247
VALIDATED
HNRNPA3 MISSION shRNA Bacterial Glycerol Stock
heterogeneous nuclear ribonucleoprotein A3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000074508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_194247.1-128s1c1
Sequence:CCGGGCTTTGAAACTACAGATGATACTCGAGTATCATCTGTAGTTTCAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194247.1-564s1c1
Sequence:CCGGCCACACTATTAATGGGCATAACTCGAGTTATGCCCATTAATAGTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_194247.1-790s1c1
Sequence:CCGGGATGGTGGATATAATGGATTTCTCGAGAAATCCATTATATCCACCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194247.1-799s1c1
Sequence:CCGGTATAATGGATTTGGAGGTGATCTCGAGATCACCTCCAAATCCATTATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_194247.1-361s1c1
Sequence:CCGGGCCCATCTAACAGTGAAGAAACTCGAGTTTCTTCACTGTTAGATGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245293    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_194247.2-2437s21c1
Sequence:CCGGCAAGGATAGTTCAGGTATAATCTCGAGATTATACCTGAACTATCCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245296    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_194247.2-4842s21c1
Sequence:CCGGCTGGTTGTTGATGGGTAATAACTCGAGTTATTACCCATCAACAACCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245297    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_194247.2-5019s21c1
Sequence:CCGGATGACTGGTTGGCTCTATTTACTCGAGTAAATAGAGCCAACCAGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245295    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_194247.2-3465s21c1
Sequence:CCGGGCCATGAGGAGAGCGATTTAACTCGAGTTAAATCGCTCTCCTCATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245294    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_194247.2-3003s21c1
Sequence:CCGGCATTTGTTAATGGGCATATATCTCGAGATATATGCCCATTAACAAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_194247
VALIDATED
HNRNPA3 MISSION shRNA shRNA Plasmid DNA
heterogeneous nuclear ribonucleoprotein A3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000074508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_194247.1-128s1c1
Sequence:CCGGGCTTTGAAACTACAGATGATACTCGAGTATCATCTGTAGTTTCAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194247.1-564s1c1
Sequence:CCGGCCACACTATTAATGGGCATAACTCGAGTTATGCCCATTAATAGTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_194247.1-790s1c1
Sequence:CCGGGATGGTGGATATAATGGATTTCTCGAGAAATCCATTATATCCACCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194247.1-799s1c1
Sequence:CCGGTATAATGGATTTGGAGGTGATCTCGAGATCACCTCCAAATCCATTATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_194247.1-361s1c1
Sequence:CCGGGCCCATCTAACAGTGAAGAAACTCGAGTTTCTTCACTGTTAGATGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245293    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_194247.2-2437s21c1
Sequence:CCGGCAAGGATAGTTCAGGTATAATCTCGAGATTATACCTGAACTATCCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245296    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_194247.2-4842s21c1
Sequence:CCGGCTGGTTGTTGATGGGTAATAACTCGAGTTATTACCCATCAACAACCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245297    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_194247.2-5019s21c1
Sequence:CCGGATGACTGGTTGGCTCTATTTACTCGAGTAAATAGAGCCAACCAGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245295    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_194247.2-3465s21c1
Sequence:CCGGGCCATGAGGAGAGCGATTTAACTCGAGTTAAATCGCTCTCCTCATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245294    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_194247.2-3003s21c1
Sequence:CCGGCATTTGTTAATGGGCATATATCTCGAGATATATGCCCATTAACAAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_194247
VALIDATED
HNRNPA3 MISSION shRNA Lentiviral Transduction Particles
heterogeneous nuclear ribonucleoprotein A3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000074508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_194247.1-128s1c1
Sequence:CCGGGCTTTGAAACTACAGATGATACTCGAGTATCATCTGTAGTTTCAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194247.1-564s1c1
Sequence:CCGGCCACACTATTAATGGGCATAACTCGAGTTATGCCCATTAATAGTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_194247.1-790s1c1
Sequence:CCGGGATGGTGGATATAATGGATTTCTCGAGAAATCCATTATATCCACCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194247.1-799s1c1
Sequence:CCGGTATAATGGATTTGGAGGTGATCTCGAGATCACCTCCAAATCCATTATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_194247.1-361s1c1
Sequence:CCGGGCCCATCTAACAGTGAAGAAACTCGAGTTTCTTCACTGTTAGATGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245293    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_194247.2-2437s21c1
Sequence:CCGGCAAGGATAGTTCAGGTATAATCTCGAGATTATACCTGAACTATCCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245296    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_194247.2-4842s21c1
Sequence:CCGGCTGGTTGTTGATGGGTAATAACTCGAGTTATTACCCATCAACAACCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245297    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_194247.2-5019s21c1
Sequence:CCGGATGACTGGTTGGCTCTATTTACTCGAGTAAATAGAGCCAACCAGTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245295    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_194247.2-3465s21c1
Sequence:CCGGGCCATGAGGAGAGCGATTTAACTCGAGTTAAATCGCTCTCCTCATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245294    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_194247.2-3003s21c1
Sequence:CCGGCATTTGTTAATGGGCATATATCTCGAGATATATGCCCATTAACAAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)