EMAIL THIS PAGE TO A FRIEND

HNRNPA3P1

heterogeneous nuclear ribonucleoprotein A3 pseudogene 1

9 Gene Product Result for
Synonyms: D10S102 FBRNP HNRPA3 HNRPA3P1
Species: Human HNRNPA3P1(10151)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005758 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005758 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005758 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NR_002726 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_002726 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00376423 predicted 2804
2 SASI_Hs02_00376424 predicted 2799
3 SASI_Hs02_00376425 predicted 2839
4 SASI_Hs02_00376426 predicted 2371
5 SASI_Hs02_00376427 predicted 2499
6 SASI_Hs02_00376428 predicted 2332
7 SASI_Hs02_00376429 predicted 2849
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005758
HNRNPA3P1 MISSION shRNA Bacterial Glycerol Stock
heterogeneous nuclear ribonucleoprotein A3 pseudogene 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000039568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005758.1-272s1c1
Sequence:CCGGTGACTTATTCTTGTGTTACAGCTCGAGCTGTAACACAAGAATAAGTCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005758.1-812s1c1
Sequence:CCGGGAGGAGGTGATGTGGATATAACTCGAGTTATATCCACATCACCTCCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005758.1-801s1c1
Sequence:CCGGAGGTAGTTATGGAGGAGGTGACTCGAGTCACCTCCTCCATAACTACCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005758.1-818s1c1
Sequence:CCGGGTGATGTGGATATAATGGATTCTCGAGAATCCATTATATCCACATCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039569    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005758.1-2226s1c1
Sequence:CCGGGAGGCCCATAAATCTTGAGTTCTCGAGAACTCAAGATTTATGGGCCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005758
HNRNPA3P1 MISSION shRNA shRNA Plasmid DNA
heterogeneous nuclear ribonucleoprotein A3 pseudogene 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000039568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005758.1-272s1c1
Sequence:CCGGTGACTTATTCTTGTGTTACAGCTCGAGCTGTAACACAAGAATAAGTCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005758.1-812s1c1
Sequence:CCGGGAGGAGGTGATGTGGATATAACTCGAGTTATATCCACATCACCTCCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005758.1-801s1c1
Sequence:CCGGAGGTAGTTATGGAGGAGGTGACTCGAGTCACCTCCTCCATAACTACCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005758.1-818s1c1
Sequence:CCGGGTGATGTGGATATAATGGATTCTCGAGAATCCATTATATCCACATCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039569    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005758.1-2226s1c1
Sequence:CCGGGAGGCCCATAAATCTTGAGTTCTCGAGAACTCAAGATTTATGGGCCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005758
HNRNPA3P1 MISSION shRNA Lentiviral Transduction Particles
heterogeneous nuclear ribonucleoprotein A3 pseudogene 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000039568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005758.1-272s1c1
Sequence:CCGGTGACTTATTCTTGTGTTACAGCTCGAGCTGTAACACAAGAATAAGTCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005758.1-812s1c1
Sequence:CCGGGAGGAGGTGATGTGGATATAACTCGAGTTATATCCACATCACCTCCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005758.1-801s1c1
Sequence:CCGGAGGTAGTTATGGAGGAGGTGACTCGAGTCACCTCCTCCATAACTACCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005758.1-818s1c1
Sequence:CCGGGTGATGTGGATATAATGGATTCTCGAGAATCCATTATATCCACATCACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039569    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005758.1-2226s1c1
Sequence:CCGGGAGGCCCATAAATCTTGAGTTCTCGAGAACTCAAGATTTATGGGCCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)