EMAIL THIS PAGE TO A FRIEND

HNRNPA3P5

heterogeneous nuclear ribonucleoprotein A3 pseudogene 5

10 Gene Product Result for
Species: Human HNRNPA3P5(387933)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_370728 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_370728 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_370728 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_370728 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_370728 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00282259 predicted 883
2 SASI_Hs01_00282260 predicted 881
3 SASI_Hs01_00282261 predicted 892
4 SASI_Hs01_00282262 predicted 889
5 SASI_Hs01_00282263 predicted 896
6 SASI_Hs01_00282264 predicted 893
7 SASI_Hs01_00282265 predicted 889
8 SASI_Hs01_00282266 predicted 870
9 SASI_Hs01_00282267 predicted 888
10 SASI_Hs01_00282268 predicted 874
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_370728
HNRNPA3P5 MISSION shRNA Bacterial Glycerol Stock
heterogeneous nuclear ribonucleoprotein A3 pseudogene 5
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000017238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370728.2-827s1c1
Sequence:CCGGGTGGTGGATATGGTAGCAGAACTCGAGTTCTGCTACCATATCCACCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370728.2-636s1c1
Sequence:CCGGTGGAGGATATGATGGTTACAACTCGAGTTGTAACCATCATATCCTCCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370728.2-160s1c1
Sequence:CCGGTGTAGCAAGATTGAAACCATACTCGAGTATGGTTTCAATCTTGCTACATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370728.2-794s1c1
Sequence:CCGGCCTATGGTGGTGGTTATGGATCTCGAGATCCATAACCACCACCATAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370728.2-55s1c1
Sequence:CCGGGAGGATTCTGTAAAGCCCGTTCTCGAGAACGGGCTTTACAGAATCCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_370728
HNRNPA3P5 MISSION shRNA shRNA Plasmid DNA
heterogeneous nuclear ribonucleoprotein A3 pseudogene 5
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000017238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370728.2-827s1c1
Sequence:CCGGGTGGTGGATATGGTAGCAGAACTCGAGTTCTGCTACCATATCCACCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370728.2-636s1c1
Sequence:CCGGTGGAGGATATGATGGTTACAACTCGAGTTGTAACCATCATATCCTCCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370728.2-160s1c1
Sequence:CCGGTGTAGCAAGATTGAAACCATACTCGAGTATGGTTTCAATCTTGCTACATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370728.2-794s1c1
Sequence:CCGGCCTATGGTGGTGGTTATGGATCTCGAGATCCATAACCACCACCATAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370728.2-55s1c1
Sequence:CCGGGAGGATTCTGTAAAGCCCGTTCTCGAGAACGGGCTTTACAGAATCCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_370728
HNRNPA3P5 MISSION shRNA Lentiviral Transduction Particles
heterogeneous nuclear ribonucleoprotein A3 pseudogene 5
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000017238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370728.2-827s1c1
Sequence:CCGGGTGGTGGATATGGTAGCAGAACTCGAGTTCTGCTACCATATCCACCACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370728.2-636s1c1
Sequence:CCGGTGGAGGATATGATGGTTACAACTCGAGTTGTAACCATCATATCCTCCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370728.2-160s1c1
Sequence:CCGGTGTAGCAAGATTGAAACCATACTCGAGTATGGTTTCAATCTTGCTACATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370728.2-794s1c1
Sequence:CCGGCCTATGGTGGTGGTTATGGATCTCGAGATCCATAACCACCACCATAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370728.2-55s1c1
Sequence:CCGGGAGGATTCTGTAAAGCCCGTTCTCGAGAACGGGCTTTACAGAATCCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)