EMAIL THIS PAGE TO A FRIEND

HNRNPAB

heterogeneous nuclear ribonucleoprotein A/B

122 Gene Product Result for
Synonyms: ABBP1 HNRPAB
UniProtKB ID: Q99729, B3KNN5, D3DWP7, Q04150, Q8N7U3, Q9BQ99
Gene ID:
Human(3182) Summary: This gene belongs to the subfamily of ubiquitously expressed heterogeneous nuclear ribonucleoproteins (hnRNPs). The hnRNPs are produced by RNA polymerase II and are components of the heterogeneous nuclear RNA (hnRNA) complexes. They are associated with pre-mRNAs in the nucleus and appear to influence pre-mRNA processing and other aspects of mRNA metabolism and transport. While all of the hnRNPs are present in the nucleus, some seem to shuttle between the nucleus and the cytoplasm. The hnRNP proteins have distinct nucleic acid binding properties. The protein encoded by this gene, which binds to one of the components of the multiprotein editosome complex, has two repeats of quasi-RRM (RNA recognition motif) domains that bind to RNAs. Two alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
Mouse(15384) heterogeneous nuclear ribonucleoprotein A/B
Rat(83498) heterogeneous nuclear ribonucleoprotein A/B
Zebrafish(321466) heterogeneous nuclear ribonucleoprotein A/B
cow(513410) heterogeneous nuclear ribonucleoprotein A/B
domestic cat(101098918) heterogeneous nuclear ribonucleoprotein A/B
chicken(396268) heterogeneous nuclear ribonucleoprotein A/B
dog(403666) heterogeneous nuclear ribonucleoprotein A/B
dog(607578) heterogeneous nuclear ribonucleoprotein A/B
sheep(101103808) heterogeneous nuclear ribonucleoprotein A/B
sheep(100135702) heterogeneous nuclear ribonucleoprotein A/B
domestic guinea pig(100728928) heterogeneous nuclear ribonucleoprotein A/B
naked mole-rat(101714563) heterogeneous nuclear ribonucleoprotein A/B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004499 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004499 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004499 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010448 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010448 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010448 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004499 Rosetta Predictions human pricing
NM_031266 Rosetta Predictions human pricing
NM_031330 Rosetta Predictions rat pricing
NM_001048061 Rosetta Predictions mouse pricing
NM_010448 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004499 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00048471 predicted 785
2 SASI_Hs01_00048472 predicted 1410
3 SASI_Hs02_00337752 predicted 762
4 SASI_Hs02_00337753 predicted 767
5 SASI_Hs01_00048473 predicted 804
6 SASI_Hs01_00048474 predicted 620
7 SASI_Hs01_00048475 predicted 1419
8 SASI_Hs01_00048476 predicted 1422
9 SASI_Hs01_00048478 predicted 799
10 SASI_Hs01_00048479 predicted 795
11 SASI_Hs01_00048470 predicted 703
12 SASI_Hs01_00048477 predicted 734
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031266 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00187587 predicted 789
2 SASI_Hs01_00187588 predicted 1546
3 SASI_Hs02_00358676 predicted 761
4 SASI_Hs02_00358677 predicted 765
5 SASI_Hs01_00187589 predicted 808
6 SASI_Hs01_00187590 predicted 620
7 SASI_Hs01_00187591 predicted 1557
8 SASI_Hs01_00187592 predicted 1558
9 SASI_Hs01_00187594 predicted 794
10 SASI_Hs01_00187595 predicted 798
11 SASI_Hs01_00187586 predicted 705
12 SASI_Hs01_00187593 predicted 731
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031330 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00121746 predicted 536
2 SASI_Rn01_00121747 predicted 1115
3 SASI_Rn01_00121748 predicted 1126
4 SASI_Rn01_00121750 predicted 1106
5 SASI_Rn01_00121751 predicted 755
6 SASI_Rn01_00121745 predicted 991
7 SASI_Rn02_00264551 predicted 1030
8 SASI_Rn02_00264552 predicted 897
9 SASI_Rn01_00121753 predicted 724
10 SASI_Rn01_00121754 predicted 757
11 SASI_Rn01_00121749 predicted 657
12 SASI_Rn01_00121752 predicted 893
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001048061 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00292001 predicted 1525
2 SASI_Mm02_00292002 predicted 1461
3 SASI_Mm02_00292003 predicted 1623
4 SASI_Mm02_00292004 predicted 1664
5 SASI_Mm02_00292005 predicted 1461
6 SASI_Mm02_00292006 predicted 571
7 SASI_Mm02_00292007 predicted 804
8 SASI_Mm02_00292008 predicted 1671
9 SASI_Mm02_00292009 predicted 564
10 SASI_Mm02_00292010 predicted 1618
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010448 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00318609 predicted 1380
2 SASI_Mm02_00318610 predicted 1326
3 SASI_Mm02_00318611 predicted 1476
4 SASI_Mm02_00318612 predicted 1525
5 SASI_Mm02_00318613 predicted 1324
6 SASI_Mm02_00318614 predicted 572
7 SASI_Mm02_00318615 predicted 804
8 SASI_Mm02_00318616 predicted 1525
9 SASI_Mm02_00318617 predicted 561
10 SASI_Mm02_00318618 predicted 1479
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004499
VALIDATED
HNRNPAB MISSION shRNA Bacterial Glycerol Stock
heterogeneous nuclear ribonucleoprotein A/B
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000074518    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004499.3-1418s1c1
Sequence:CCGGCCCTGGTTGTAAAGAGTAAATCTCGAGATTTACTCTTTACAACCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_004499.3-806s1c1
Sequence:CCGGTGAATTGCCAATGGATCCAAACTCGAGTTTGGATCCATTGGCAATTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_004499.3-797s1c1
Sequence:CCGGTGAGGCCATTGAATTGCCAATCTCGAGATTGGCAATTCAATGGCCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004499.3-1091s1c1
Sequence:CCGGTCAGAATAACTACAAGCCATACTCGAGTATGGCTTGTAGTTATTCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004499.3-917s1c1
Sequence:CCGGTGGAAGCAAGTGTGAGATCAACTCGAGTTGATCTCACACTTGCTTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004499.3-666s21c1
Sequence:CCGGGGCCGTGTCATTGACCCTAAACTCGAGTTTAGGGTCAATGACACGGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300635    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004499.3-1418s21c1
Sequence:CCGGCCCTGGTTGTAAAGAGTAAATCTCGAGATTTACTCTTTACAACCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004499.3-917s21c1
Sequence:CCGGTGGAAGCAAGTGTGAGATCAACTCGAGTTGATCTCACACTTGCTTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004499.3-1091s21c1
Sequence:CCGGTCAGAATAACTACAAGCCATACTCGAGTATGGCTTGTAGTTATTCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004499.3-542s21c1
Sequence:CCGGGGTCGTTGACTGTACAATAAACTCGAGTTTATTGTACAGTCAACGACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004499
VALIDATED
HNRNPAB MISSION shRNA shRNA Plasmid DNA
heterogeneous nuclear ribonucleoprotein A/B
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000074518    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004499.3-1418s1c1
Sequence:CCGGCCCTGGTTGTAAAGAGTAAATCTCGAGATTTACTCTTTACAACCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_004499.3-806s1c1
Sequence:CCGGTGAATTGCCAATGGATCCAAACTCGAGTTTGGATCCATTGGCAATTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_004499.3-797s1c1
Sequence:CCGGTGAGGCCATTGAATTGCCAATCTCGAGATTGGCAATTCAATGGCCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004499.3-1091s1c1
Sequence:CCGGTCAGAATAACTACAAGCCATACTCGAGTATGGCTTGTAGTTATTCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004499.3-917s1c1
Sequence:CCGGTGGAAGCAAGTGTGAGATCAACTCGAGTTGATCTCACACTTGCTTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004499.3-666s21c1
Sequence:CCGGGGCCGTGTCATTGACCCTAAACTCGAGTTTAGGGTCAATGACACGGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300635    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004499.3-1418s21c1
Sequence:CCGGCCCTGGTTGTAAAGAGTAAATCTCGAGATTTACTCTTTACAACCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004499.3-917s21c1
Sequence:CCGGTGGAAGCAAGTGTGAGATCAACTCGAGTTGATCTCACACTTGCTTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004499.3-1091s21c1
Sequence:CCGGTCAGAATAACTACAAGCCATACTCGAGTATGGCTTGTAGTTATTCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004499.3-542s21c1
Sequence:CCGGGGTCGTTGACTGTACAATAAACTCGAGTTTATTGTACAGTCAACGACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004499
VALIDATED
HNRNPAB MISSION shRNA Lentiviral Transduction Particles
heterogeneous nuclear ribonucleoprotein A/B
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000074518    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004499.3-1418s1c1
Sequence:CCGGCCCTGGTTGTAAAGAGTAAATCTCGAGATTTACTCTTTACAACCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_004499.3-806s1c1
Sequence:CCGGTGAATTGCCAATGGATCCAAACTCGAGTTTGGATCCATTGGCAATTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_004499.3-797s1c1
Sequence:CCGGTGAGGCCATTGAATTGCCAATCTCGAGATTGGCAATTCAATGGCCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004499.3-1091s1c1
Sequence:CCGGTCAGAATAACTACAAGCCATACTCGAGTATGGCTTGTAGTTATTCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004499.3-917s1c1
Sequence:CCGGTGGAAGCAAGTGTGAGATCAACTCGAGTTGATCTCACACTTGCTTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004499.3-666s21c1
Sequence:CCGGGGCCGTGTCATTGACCCTAAACTCGAGTTTAGGGTCAATGACACGGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300635    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004499.3-1418s21c1
Sequence:CCGGCCCTGGTTGTAAAGAGTAAATCTCGAGATTTACTCTTTACAACCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004499.3-917s21c1
Sequence:CCGGTGGAAGCAAGTGTGAGATCAACTCGAGTTGATCTCACACTTGCTTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004499.3-1091s21c1
Sequence:CCGGTCAGAATAACTACAAGCCATACTCGAGTATGGCTTGTAGTTATTCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004499.3-542s21c1
Sequence:CCGGGGTCGTTGACTGTACAATAAACTCGAGTTTATTGTACAGTCAACGACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010448
VALIDATED
HNRNPAB MISSION shRNA Bacterial Glycerol Stock
heterogeneous nuclear ribonucleoprotein A/B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010448.2-880s1c1
Sequence:CCGGTGGAAGCAAGTGTGAAATCAACTCGAGTTGATTTCACACTTGCTTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103640    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010448.2-2193s1c1
Sequence:CCGGCCCTCTAAGAAATGTATCAATCTCGAGATTGATACATTTCTTAGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010448.2-761s1c1
Sequence:CCGGGAGGCCATTGAGCTTCCAATACTCGAGTATTGGAAGCTCAATGGCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010448.2-730s1c1
Sequence:CCGGCAGAGAATACTTCGGCCAGTTCTCGAGAACTGGCCGAAGTATTCTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010448.2-764s1c1
Sequence:CCGGGCCATTGAGCTTCCAATAGATCTCGAGATCTATTGGAAGCTCAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010448
VALIDATED
HNRNPAB MISSION shRNA shRNA Plasmid DNA
heterogeneous nuclear ribonucleoprotein A/B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010448.2-880s1c1
Sequence:CCGGTGGAAGCAAGTGTGAAATCAACTCGAGTTGATTTCACACTTGCTTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103640    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010448.2-2193s1c1
Sequence:CCGGCCCTCTAAGAAATGTATCAATCTCGAGATTGATACATTTCTTAGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010448.2-761s1c1
Sequence:CCGGGAGGCCATTGAGCTTCCAATACTCGAGTATTGGAAGCTCAATGGCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010448.2-730s1c1
Sequence:CCGGCAGAGAATACTTCGGCCAGTTCTCGAGAACTGGCCGAAGTATTCTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010448.2-764s1c1
Sequence:CCGGGCCATTGAGCTTCCAATAGATCTCGAGATCTATTGGAAGCTCAATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010448
VALIDATED
HNRNPAB MISSION shRNA Lentiviral Transduction Particles
heterogeneous nuclear ribonucleoprotein A/B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010448.2-880s1c1
Sequence:CCGGTGGAAGCAAGTGTGAAATCAACTCGAGTTGATTTCACACTTGCTTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103640    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010448.2-2193s1c1
Sequence:CCGGCCCTCTAAGAAATGTATCAATCTCGAGATTGATACATTTCTTAGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010448.2-761s1c1
Sequence:CCGGGAGGCCATTGAGCTTCCAATACTCGAGTATTGGAAGCTCAATGGCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010448.2-730s1c1
Sequence:CCGGCAGAGAATACTTCGGCCAGTTCTCGAGAACTGGCCGAAGTATTCTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010448.2-764s1c1
Sequence:CCGGGCCATTGAGCTTCCAATAGATCTCGAGATCTATTGGAAGCTCAATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)