EMAIL THIS PAGE TO A FRIEND

HNRNPC

heterogeneous nuclear ribonucleoprotein C (C1/C2)

151 Gene Product Result for
Synonyms: C1 C2 HNRNP HNRPC SNRPC
Gene ID:
Human(3183) Summary: This gene belongs to the subfamily of ubiquitously expressed heterogeneous nuclear ribonucleoproteins (hnRNPs). The hnRNPs are RNA binding proteins and they complex with heterogeneous nuclear RNA (hnRNA). These proteins are associated with pre-mRNAs in the nucleus and appear to influence pre-mRNA processing and other aspects of mRNA metabolism and transport. While all of the hnRNPs are present in the nucleus, some seem to shuttle between the nucleus and the cytoplasm. The hnRNP proteins have distinct nucleic acid binding properties. The protein encoded by this gene can act as a tetramer and is involved in the assembly of 40S hnRNP particles. Multiple transcript variants encoding at least two different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
Mouse(15381) heterogeneous nuclear ribonucleoprotein C
Rat(290046) heterogeneous nuclear ribonucleoprotein C (C1/C2)
Zebrafish(406352) heterogeneous nuclear ribonucleoprotein C
dog(475399) heterogeneous nuclear ribonucleoprotein C (C1/C2)
Goat(100860966) heterogeneous nuclear ribonucleoprotein C (C1/C2)
Domestic Rabbit(100008686) heterogeneous nuclear ribonucleoprotein C (C1/C2)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4501418 Anti-HNRNP C1, C-Terminal antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB4501419 Anti-HNRNP C1, C-Terminal antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB2101056 Anti-HNRNPC antibody produced in rabbit affinity isolated antibody human, rat, bovine, mouse, zebrafish, rabbit, horse, rabbit, canine, guinea pig
western blot pricing
HPA051075 Anti-HNRNPC antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
AV41037 Anti-HNRPC antibody produced in rabbit affinity isolated antibody rabbit, rabbit, canine, mouse, human, rat
western blot pricing
SAB4504228 Anti-phospho-hnRNP C1/2 (pSer260) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB4301544 Anti-phospho-hnRNP C1/2 (pSer260) antibody produced in rabbit affinity isolated antibody human
western blot pricing
R5028 Monoclonal Anti-hnRNP-C1/C2 antibody produced in mouse clone 4F4, purified immunoglobulin, buffered aqueous solution monkey, hamster, human, chicken
ELISA, immunocytochemistry, immunoprecipitation (IP), microarray, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031314 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031314 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031314 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016884 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016884 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016884 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001077442 Rosetta Predictions human pricing
NM_001077443 Rosetta Predictions human pricing
NM_004500 Rosetta Predictions human pricing
NM_031314 Rosetta Predictions human pricing
NM_001025633 Rosetta Predictions rat pricing
NM_016884 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077442 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00312564 predicted 893
2 SASI_Hs02_00312565 predicted 1515
3 SASI_Hs02_00312566 predicted 1266
4 SASI_Hs02_00312567 predicted 1562
5 SASI_Hs02_00312568 predicted 1269
6 SASI_Hs02_00312569 predicted 1565
7 SASI_Hs02_00312570 predicted 1372
8 SASI_Hs02_00312571 predicted 1321
9 SASI_Hs02_00312572 predicted 874
10 SASI_Hs02_00312573 predicted 1181
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077443 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00312574 predicted 853
2 SASI_Hs02_00312575 predicted 1475
3 SASI_Hs02_00312576 predicted 1234
4 SASI_Hs02_00312577 predicted 1531
5 SASI_Hs02_00312578 predicted 1235
6 SASI_Hs02_00312579 predicted 1525
7 SASI_Hs02_00312580 predicted 1332
8 SASI_Hs02_00312581 predicted 1280
9 SASI_Hs02_00312582 predicted 834
10 SASI_Hs02_00312583 predicted 1147
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004500 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00337754 predicted 882
2 SASI_Hs01_00010782 predicted 1509
3 SASI_Hs02_00337755 predicted 1257
4 SASI_Hs02_00337756 predicted 1556
5 SASI_Hs01_00010784 predicted 1257
6 SASI_Hs01_00010785 predicted 1549
7 SASI_Hs01_00010786 predicted 1364
8 SASI_Hs02_00337757 predicted 1309
9 SASI_Hs01_00010787 predicted 863
10 SASI_Hs01_00010788 predicted 1170
11 SASI_Hs01_00010781 predicted 1044
12 SASI_Hs01_00010783 predicted 1484
13 SASI_Hs01_00010789 predicted 1310
14 SASI_Hs01_00010790 predicted 1498
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031314 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00358760 predicted 922
2 SASI_Hs01_00158395 predicted 1542
3 SASI_Hs02_00358761 predicted 1291
4 SASI_Hs02_00358762 predicted 1589
5 SASI_Hs01_00158397 predicted 1296
6 SASI_Hs01_00158398 predicted 1594
7 SASI_Hs01_00158399 predicted 1397
8 SASI_Hs02_00358763 predicted 1341
9 SASI_Hs01_00158400 predicted 904
10 SASI_Hs01_00158401 predicted 1214
11 SASI_Hs01_00158394 predicted 1094
12 SASI_Hs01_00158396 predicted 1527
13 SASI_Hs01_00158402 predicted 1353
14 SASI_Hs01_00158403 predicted 1548
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025633 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00061292 predicted 466
2 SASI_Rn01_00061293 predicted 1036
3 SASI_Rn01_00061294 predicted 476
4 SASI_Rn01_00061295 predicted 455
5 SASI_Rn01_00061296 predicted 1028
6 SASI_Rn01_00061297 predicted 1059
7 SASI_Rn01_00061298 predicted 1030
8 SASI_Rn01_00061299 predicted 1016
9 SASI_Rn01_00061300 predicted 281
10 SASI_Rn01_00061301 predicted 267
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016884 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00149771 predicted 1093
2 SASI_Mm01_00149772 predicted 1093
3 SASI_Mm01_00149773 predicted 527
4 SASI_Mm01_00149774 predicted 1121
5 SASI_Mm01_00149775 predicted 1088
6 SASI_Mm01_00149776 predicted 1114
7 SASI_Mm01_00149777 predicted 1098
8 SASI_Mm01_00149778 predicted 633
9 SASI_Mm01_00149779 predicted 1112
10 SASI_Mm01_00149780 predicted 1101
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031314
VALIDATED
HNRNPC MISSION shRNA Bacterial Glycerol Stock
heterogeneous nuclear ribonucleoprotein C (C1/C2)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031314.2-554s21c1
Sequence:CCGGATGTACGGGTCAGTAACAGAACTCGAGTTCTGTTACTGACCCGTACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031314.2-1043s21c1
Sequence:CCGGCTGGATGATGATGATAATGAACTCGAGTTCATTATCATCATCATCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031314.2-628s21c1
Sequence:CCGGTCAACGGGACTATTATGATAGCTCGAGCTATCATAATAGTCCCGTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320716    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031314.2-1213s21c1
Sequence:CCGGGCGCTTGTCTAAGATCAAATTCTCGAGAATTTGATCTTAGACAAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031314.2-401s21c1
Sequence:CCGGGCCTTCGTTCAGTATGTTAATCTCGAGATTAACATACTGAACGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031314.1-495s1c1
Sequence:CCGGGCGGAGATGTACGGGTCAGTACTCGAGTACTGACCCGTACATCTCCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006644    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_031314.1-1158s1c1
Sequence:CCGGGCGCTTGTCTAAGATCAAATTCTCGAGAATTTGATCTTAGACAAGCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_031314.1-348s1c1
Sequence:CCGGGCCTTCGTTCAGTATGTTAATCTCGAGATTAACATACTGAACGAAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_031314.1-990s1c1
Sequence:CCGGCTGGATGATGATGATAATGAACTCGAGTTCATTATCATCATCATCCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_031314.1-267s1c1
Sequence:CCGGCTTGTGGTCAAGAAATCTGATCTCGAGATCAGATTTCTTGACCACAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031314
VALIDATED
HNRNPC MISSION shRNA shRNA Plasmid DNA
heterogeneous nuclear ribonucleoprotein C (C1/C2)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031314.2-554s21c1
Sequence:CCGGATGTACGGGTCAGTAACAGAACTCGAGTTCTGTTACTGACCCGTACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031314.2-1043s21c1
Sequence:CCGGCTGGATGATGATGATAATGAACTCGAGTTCATTATCATCATCATCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031314.2-628s21c1
Sequence:CCGGTCAACGGGACTATTATGATAGCTCGAGCTATCATAATAGTCCCGTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320716    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031314.2-1213s21c1
Sequence:CCGGGCGCTTGTCTAAGATCAAATTCTCGAGAATTTGATCTTAGACAAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031314.2-401s21c1
Sequence:CCGGGCCTTCGTTCAGTATGTTAATCTCGAGATTAACATACTGAACGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031314.1-495s1c1
Sequence:CCGGGCGGAGATGTACGGGTCAGTACTCGAGTACTGACCCGTACATCTCCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006644    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_031314.1-1158s1c1
Sequence:CCGGGCGCTTGTCTAAGATCAAATTCTCGAGAATTTGATCTTAGACAAGCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_031314.1-348s1c1
Sequence:CCGGGCCTTCGTTCAGTATGTTAATCTCGAGATTAACATACTGAACGAAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_031314.1-990s1c1
Sequence:CCGGCTGGATGATGATGATAATGAACTCGAGTTCATTATCATCATCATCCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_031314.1-267s1c1
Sequence:CCGGCTTGTGGTCAAGAAATCTGATCTCGAGATCAGATTTCTTGACCACAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031314
VALIDATED
HNRNPC MISSION shRNA Lentiviral Transduction Particles
heterogeneous nuclear ribonucleoprotein C (C1/C2)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031314.2-554s21c1
Sequence:CCGGATGTACGGGTCAGTAACAGAACTCGAGTTCTGTTACTGACCCGTACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031314.2-1043s21c1
Sequence:CCGGCTGGATGATGATGATAATGAACTCGAGTTCATTATCATCATCATCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031314.2-628s21c1
Sequence:CCGGTCAACGGGACTATTATGATAGCTCGAGCTATCATAATAGTCCCGTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320716    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031314.2-1213s21c1
Sequence:CCGGGCGCTTGTCTAAGATCAAATTCTCGAGAATTTGATCTTAGACAAGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031314.2-401s21c1
Sequence:CCGGGCCTTCGTTCAGTATGTTAATCTCGAGATTAACATACTGAACGAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031314.1-495s1c1
Sequence:CCGGGCGGAGATGTACGGGTCAGTACTCGAGTACTGACCCGTACATCTCCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006644    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_031314.1-1158s1c1
Sequence:CCGGGCGCTTGTCTAAGATCAAATTCTCGAGAATTTGATCTTAGACAAGCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_031314.1-348s1c1
Sequence:CCGGGCCTTCGTTCAGTATGTTAATCTCGAGATTAACATACTGAACGAAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_031314.1-990s1c1
Sequence:CCGGCTGGATGATGATGATAATGAACTCGAGTTCATTATCATCATCATCCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_031314.1-267s1c1
Sequence:CCGGCTTGTGGTCAAGAAATCTGATCTCGAGATCAGATTTCTTGACCACAAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016884
VALIDATED
HNRNPC MISSION shRNA Bacterial Glycerol Stock
heterogeneous nuclear ribonucleoprotein C (C1/C2)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000348398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016884.2-502s21c1
Sequence:CCGGCCTCTACTCAGTTCCTCATTTCTCGAGAAATGAGGAACTGAGTAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016884.2-313s21c1
Sequence:CCGGGCCTTTGTCCAGTATGTTAATCTCGAGATTAACATACTGGACAAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334964    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016884.2-1111s21c1
Sequence:CCGGGCTTAGAAATCTTATCCCATTCTCGAGAATGGGATAAGATTTCTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016884.2-729s21c1
Sequence:CCGGTGATGACCTTCAGGCCATTAACTCGAGTTAATGGCCTGAAGGTCATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112055    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016884.1-1111s1c1
Sequence:CCGGGCTTAGAAATCTTATCCCATTCTCGAGAATGGGATAAGATTTCTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016884.1-501s1c1
Sequence:CCGGCCCTCTACTCAGTTCCTCATTCTCGAGAATGAGGAACTGAGTAGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016884.1-854s1c1
Sequence:CCGGCAGTAGAGATGAAGAATGAAACTCGAGTTTCATTCTTCATCTCTACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016884.1-313s1c1
Sequence:CCGGGCCTTTGTCCAGTATGTTAATCTCGAGATTAACATACTGGACAAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016884.1-975s1c1
Sequence:CCGGCCTGCTGGATGATGACGATAACTCGAGTTATCGTCATCATCCAGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016884
VALIDATED
HNRNPC MISSION shRNA shRNA Plasmid DNA
heterogeneous nuclear ribonucleoprotein C (C1/C2)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000348398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016884.2-502s21c1
Sequence:CCGGCCTCTACTCAGTTCCTCATTTCTCGAGAAATGAGGAACTGAGTAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016884.2-313s21c1
Sequence:CCGGGCCTTTGTCCAGTATGTTAATCTCGAGATTAACATACTGGACAAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334964    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016884.2-1111s21c1
Sequence:CCGGGCTTAGAAATCTTATCCCATTCTCGAGAATGGGATAAGATTTCTAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016884.2-729s21c1
Sequence:CCGGTGATGACCTTCAGGCCATTAACTCGAGTTAATGGCCTGAAGGTCATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112055    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016884.1-1111s1c1
Sequence:CCGGGCTTAGAAATCTTATCCCATTCTCGAGAATGGGATAAGATTTCTAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016884.1-501s1c1
Sequence:CCGGCCCTCTACTCAGTTCCTCATTCTCGAGAATGAGGAACTGAGTAGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016884.1-854s1c1
Sequence:CCGGCAGTAGAGATGAAGAATGAAACTCGAGTTTCATTCTTCATCTCTACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016884.1-313s1c1
Sequence:CCGGGCCTTTGTCCAGTATGTTAATCTCGAGATTAACATACTGGACAAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016884.1-975s1c1
Sequence:CCGGCCTGCTGGATGATGACGATAACTCGAGTTATCGTCATCATCCAGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016884
VALIDATED
HNRNPC MISSION shRNA Lentiviral Transduction Particles
heterogeneous nuclear ribonucleoprotein C (C1/C2)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000348398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016884.2-502s21c1
Sequence:CCGGCCTCTACTCAGTTCCTCATTTCTCGAGAAATGAGGAACTGAGTAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016884.2-313s21c1
Sequence:CCGGGCCTTTGTCCAGTATGTTAATCTCGAGATTAACATACTGGACAAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334964    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016884.2-1111s21c1
Sequence:CCGGGCTTAGAAATCTTATCCCATTCTCGAGAATGGGATAAGATTTCTAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016884.2-729s21c1
Sequence:CCGGTGATGACCTTCAGGCCATTAACTCGAGTTAATGGCCTGAAGGTCATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112055    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016884.1-1111s1c1
Sequence:CCGGGCTTAGAAATCTTATCCCATTCTCGAGAATGGGATAAGATTTCTAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016884.1-501s1c1
Sequence:CCGGCCCTCTACTCAGTTCCTCATTCTCGAGAATGAGGAACTGAGTAGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016884.1-854s1c1
Sequence:CCGGCAGTAGAGATGAAGAATGAAACTCGAGTTTCATTCTTCATCTCTACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016884.1-313s1c1
Sequence:CCGGGCCTTTGTCCAGTATGTTAATCTCGAGATTAACATACTGGACAAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016884.1-975s1c1
Sequence:CCGGCCTGCTGGATGATGACGATAACTCGAGTTATCGTCATCATCCAGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)