EMAIL THIS PAGE TO A FRIEND

HNRNPCL1

heterogeneous nuclear ribonucleoprotein C-like 1

8 Gene Product Result for
Synonyms: HNRPCL1
UniProtKB ID: O60812, B2RP44
Gene ID:
dog(474964) heterogeneous nuclear ribonucleoprotein C-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301085 ANTI-HNRNPCL1 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001013631 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001013631 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001013631 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU128621 MISSION® esiRNA esiRNA human HNRNPCL1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013631 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013631 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00086059 predicted 656
2 SASI_Hs01_00086056 predicted 648
3 SASI_Hs01_00086057 predicted 653
4 SASI_Hs01_00086058 predicted 652
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013631
HNRNPCL1 MISSION shRNA Bacterial Glycerol Stock
heterogeneous nuclear ribonucleoprotein C-like 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000075086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013631.1-702s1c1
Sequence:CCGGGCTTCAATTCTAAGAGTGGAACTCGAGTTCCACTCTTAGAATTGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013631.1-297s1c1
Sequence:CCGGACACTCTTGTTGTCAAGAAATCTCGAGATTTCTTGACAACAAGAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013631.1-388s1c1
Sequence:CCGGCGTTCAATATGATAAGGAGAACTCGAGTTCTCCTTATCATATTGAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013631.1-651s1c1
Sequence:CCGGCCTCGAAACGTCAACGTCTATCTCGAGATAGACGTTGACGTTTCGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013631.1-778s1c1
Sequence:CCGGGCAGGAGTTGACCCAGATAAACTCGAGTTTATCTGGGTCAACTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013631.1-982s21c1
Sequence:CCGGCCCACTGGATGATGATGTTAACTCGAGTTAACATCATCATCCAGTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013631.1-563s21c1
Sequence:CCGGTATGGCTTTCAACGGGATTATCTCGAGATAATCCCGTTGAAAGCCATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013631
HNRNPCL1 MISSION shRNA shRNA Plasmid DNA
heterogeneous nuclear ribonucleoprotein C-like 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000075086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013631.1-702s1c1
Sequence:CCGGGCTTCAATTCTAAGAGTGGAACTCGAGTTCCACTCTTAGAATTGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013631.1-297s1c1
Sequence:CCGGACACTCTTGTTGTCAAGAAATCTCGAGATTTCTTGACAACAAGAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013631.1-388s1c1
Sequence:CCGGCGTTCAATATGATAAGGAGAACTCGAGTTCTCCTTATCATATTGAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013631.1-651s1c1
Sequence:CCGGCCTCGAAACGTCAACGTCTATCTCGAGATAGACGTTGACGTTTCGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013631.1-778s1c1
Sequence:CCGGGCAGGAGTTGACCCAGATAAACTCGAGTTTATCTGGGTCAACTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013631.1-982s21c1
Sequence:CCGGCCCACTGGATGATGATGTTAACTCGAGTTAACATCATCATCCAGTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013631.1-563s21c1
Sequence:CCGGTATGGCTTTCAACGGGATTATCTCGAGATAATCCCGTTGAAAGCCATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013631
HNRNPCL1 MISSION shRNA Lentiviral Transduction Particles
heterogeneous nuclear ribonucleoprotein C-like 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000075086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013631.1-702s1c1
Sequence:CCGGGCTTCAATTCTAAGAGTGGAACTCGAGTTCCACTCTTAGAATTGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013631.1-297s1c1
Sequence:CCGGACACTCTTGTTGTCAAGAAATCTCGAGATTTCTTGACAACAAGAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013631.1-388s1c1
Sequence:CCGGCGTTCAATATGATAAGGAGAACTCGAGTTCTCCTTATCATATTGAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013631.1-651s1c1
Sequence:CCGGCCTCGAAACGTCAACGTCTATCTCGAGATAGACGTTGACGTTTCGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013631.1-778s1c1
Sequence:CCGGGCAGGAGTTGACCCAGATAAACTCGAGTTTATCTGGGTCAACTCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013631.1-982s21c1
Sequence:CCGGCCCACTGGATGATGATGTTAACTCGAGTTAACATCATCATCCAGTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013631.1-563s21c1
Sequence:CCGGTATGGCTTTCAACGGGATTATCTCGAGATAATCCCGTTGAAAGCCATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)