EMAIL THIS PAGE TO A FRIEND

HNRNPCP5

heterogeneous nuclear ribonucleoprotein C pseudogene 5

20 Gene Product Result for
Species: Human HNRNPCP5(440563)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001136561 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001136561 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001136561 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_001714578 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_001714578 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_001714578 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001714578 Rosetta Predictions human pricing
XM_001720694 Rosetta Predictions human pricing
XM_001721509 Rosetta Predictions human pricing
XM_001726972 Rosetta Predictions human pricing
XM_496344 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001714578 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00398079 predicted 638
2 SASI_Hs02_00398080 predicted 626
3 SASI_Hs02_00398081 predicted 1125
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001720694 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00438290 predicted 987
2 SASI_Hs02_00438291 predicted 639
3 SASI_Hs02_00438292 predicted 621
4 SASI_Hs02_00438293 predicted 1131
5 SASI_Hs02_00438294 predicted 628
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001721509 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00443317 predicted 620
2 SASI_Hs02_00443318 predicted 618
3 SASI_Hs02_00443319 predicted 633
4 SASI_Hs02_00443320 predicted 1129
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001726972 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00477774 predicted 216
2 SASI_Hs02_00477775 predicted 219
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_496344 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00271744 predicted 630
2 SASI_Hs01_00271745 predicted 624
3 SASI_Hs01_00271746 predicted 621
4 SASI_Hs01_00271747 predicted 1131
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001136561
HNRNPCP5 MISSION shRNA Bacterial Glycerol Stock
heterogeneous nuclear ribonucleoprotein C pseudogene 5
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000371095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136561.1-785s21c1
Sequence:CCGGGAAAGATGAGACTCATGTAAACTCGAGTTTACATGAGTCTCATCTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136561.1-852s21c1
Sequence:CCGGCCACTGGATGATGATGATAATCTCGAGATTATCATCATCATCCAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136561.1-892s21c1
Sequence:CCGGAGCTTCATTTGATCAAGAATACTCGAGTATTCTTGATCAAATGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136561.1-522s21c1
Sequence:CCGGTCGAAACGCCAGCGCATATCACTCGAGTGATATGCGCTGGCGTTTCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001136561
HNRNPCP5 MISSION shRNA shRNA Plasmid DNA
heterogeneous nuclear ribonucleoprotein C pseudogene 5
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000371095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136561.1-785s21c1
Sequence:CCGGGAAAGATGAGACTCATGTAAACTCGAGTTTACATGAGTCTCATCTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136561.1-852s21c1
Sequence:CCGGCCACTGGATGATGATGATAATCTCGAGATTATCATCATCATCCAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136561.1-892s21c1
Sequence:CCGGAGCTTCATTTGATCAAGAATACTCGAGTATTCTTGATCAAATGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136561.1-522s21c1
Sequence:CCGGTCGAAACGCCAGCGCATATCACTCGAGTGATATGCGCTGGCGTTTCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001136561
HNRNPCP5 MISSION shRNA Lentiviral Transduction Particles
heterogeneous nuclear ribonucleoprotein C pseudogene 5
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000371095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136561.1-785s21c1
Sequence:CCGGGAAAGATGAGACTCATGTAAACTCGAGTTTACATGAGTCTCATCTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136561.1-852s21c1
Sequence:CCGGCCACTGGATGATGATGATAATCTCGAGATTATCATCATCATCCAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136561.1-892s21c1
Sequence:CCGGAGCTTCATTTGATCAAGAATACTCGAGTATTCTTGATCAAATGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136561.1-522s21c1
Sequence:CCGGTCGAAACGCCAGCGCATATCACTCGAGTGATATGCGCTGGCGTTTCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_001714578
HNRNPCP5 MISSION shRNA Bacterial Glycerol Stock
heterogeneous nuclear ribonucleoprotein C pseudogene 5
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000239536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001714578.1-538s21c1
Sequence:CCGGCTATGGCTTTCAACGGGATTACTCGAGTAATCCCGTTGAAAGCCATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001714578.1-352s21c1
Sequence:CCGGGGGCTTTGCCTTCGTTCAATACTCGAGTATTGAACGAAGGCAAAGCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001714578.1-425s21c1
Sequence:CCGGATTGCTAGCCAGGTTGCAGTTCTCGAGAACTGCAACCTGGCTAGCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239539    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001714578.1-1159s21c1
Sequence:CCGGCAGATCCTCTCCCTTAGTATCCTCGAGGATACTAAGGGAGAGGATCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001714578.1-734s21c1
Sequence:CCGGGATGACCTTCAGGCCATTAAGCTCGAGCTTAATGGCCTGAAGGTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_001714578
HNRNPCP5 MISSION shRNA shRNA Plasmid DNA
heterogeneous nuclear ribonucleoprotein C pseudogene 5
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000239536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001714578.1-538s21c1
Sequence:CCGGCTATGGCTTTCAACGGGATTACTCGAGTAATCCCGTTGAAAGCCATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001714578.1-352s21c1
Sequence:CCGGGGGCTTTGCCTTCGTTCAATACTCGAGTATTGAACGAAGGCAAAGCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001714578.1-425s21c1
Sequence:CCGGATTGCTAGCCAGGTTGCAGTTCTCGAGAACTGCAACCTGGCTAGCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239539    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001714578.1-1159s21c1
Sequence:CCGGCAGATCCTCTCCCTTAGTATCCTCGAGGATACTAAGGGAGAGGATCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001714578.1-734s21c1
Sequence:CCGGGATGACCTTCAGGCCATTAAGCTCGAGCTTAATGGCCTGAAGGTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_001714578
HNRNPCP5 MISSION shRNA Lentiviral Transduction Particles
heterogeneous nuclear ribonucleoprotein C pseudogene 5
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000239536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001714578.1-538s21c1
Sequence:CCGGCTATGGCTTTCAACGGGATTACTCGAGTAATCCCGTTGAAAGCCATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001714578.1-352s21c1
Sequence:CCGGGGGCTTTGCCTTCGTTCAATACTCGAGTATTGAACGAAGGCAAAGCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001714578.1-425s21c1
Sequence:CCGGATTGCTAGCCAGGTTGCAGTTCTCGAGAACTGCAACCTGGCTAGCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239539    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001714578.1-1159s21c1
Sequence:CCGGCAGATCCTCTCCCTTAGTATCCTCGAGGATACTAAGGGAGAGGATCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001714578.1-734s21c1
Sequence:CCGGGATGACCTTCAGGCCATTAAGCTCGAGCTTAATGGCCTGAAGGTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)