EMAIL THIS PAGE TO A FRIEND

HNRNPD

heterogeneous nuclear ribonucleoprotein D (AU-rich element RNA binding protein 1, 37kDa)

163 Gene Product Result for
Synonyms: AUF1 AUF1A HNRPD P37 hnRNPD0
Gene ID:
Human(3184) Summary: This gene belongs to the subfamily of ubiquitously expressed heterogeneous nuclear ribonucleoproteins (hnRNPs). The hnRNPs are nucleic acid binding proteins and they complex with heterogeneous nuclear RNA (hnRNA). These proteins are associated with pre-mRNAs in the nucleus and appear to influence pre-mRNA processing and other aspects of mRNA metabolism and transport. While all of the hnRNPs are present in the nucleus, some seem to shuttle between the nucleus and the cytoplasm. The hnRNP proteins have distinct nucleic acid binding properties. The protein encoded by this gene has two repeats of quasi-RRM domains that bind to RNAs. It localizes to both the nucleus and the cytoplasm. This protein is implicated in the regulation of mRNA stability. Alternative splicing of this gene results in four transcript variants. [provided by RefSeq, Jul 2008]
Mouse(11991) heterogeneous nuclear ribonucleoprotein D
Zebrafish(560522) heterogeneous nuclear ribonucleoprotein D
cow(527471) heterogeneous nuclear ribonucleoprotein D (AU-rich element RNA binding protein 1, 37kDa)
Horse(100034002) heterogeneous nuclear ribonucleoprotein D (AU-rich element RNA binding protein 1, 37kDa)
dog(478450) heterogeneous nuclear ribonucleoprotein D (AU-rich element RNA binding protein 1, 37kDa)
domestic cat(101091106) heterogeneous nuclear ribonucleoprotein D (AU-rich element RNA binding protein 1, 37kDa)
chicken(422602) heterogeneous nuclear ribonucleoprotein D (AU-rich element RNA binding protein 1, 37kDa)
sheep(101108573) heterogeneous nuclear ribonucleoprotein D (AU-rich element RNA binding protein 1, 37kDa)
sheep(100294646) heterogeneous nuclear ribonucleoprotein D (AU-rich element RNA binding protein 1, 37kDa)
domestic guinea pig(100724239) heterogeneous nuclear ribonucleoprotein D (AU-rich element RNA binding protein 1, 37kDa)
naked mole-rat(101724299) heterogeneous nuclear ribonucleoprotein D (AU-rich element RNA binding protein 1, 37kDa)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1410645 Anti-HNRNPD antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
HPA004911 ANTI-HNRNPD antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2108527 Anti-HNRPD IgG fraction of antiserum canine, bovine, guinea pig, horse, mouse, pig, rat, rat, zebrafish
immunohistochemistry, western blot pricing
AV40238 Anti-HNRPD (AB1) antibody produced in rabbit IgG fraction of antiserum rabbit, bovine, pig, mouse, canine, horse, human, guinea pig, rat, zebrafish
immunohistochemistry, western blot pricing
AV40239 Anti-HNRPD (AB2) antibody produced in rabbit IgG fraction of antiserum pig, mouse, horse, bovine, guinea pig, human, zebrafish, rat, canine
immunohistochemistry, western blot pricing
SAB1405952 Anti-HNRPD antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB4501420 Anti-HNRPD antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4504230 Anti-phospho-hnRPD (pSer83) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4301263 Anti-phospho-hnRPD (pSer83) antibody produced in rabbit affinity isolated antibody human, mouse
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007516 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007516 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007516 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_031370 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031370 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031370 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001003810 Rosetta Predictions human pricing
NM_002138 Rosetta Predictions human pricing
NM_031369 Rosetta Predictions human pricing
NM_031370 Rosetta Predictions human pricing
NM_001077265 Rosetta Predictions mouse pricing
NM_001077266 Rosetta Predictions mouse pricing
NM_001077267 Rosetta Predictions mouse pricing
NM_007516 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003810 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00304400 predicted 1324
2 SASI_Hs01_00058521 predicted 1446
3 SASI_Hs01_00058523 predicted 750
4 SASI_Hs01_00058524 predicted 1483
5 SASI_Hs01_00058528 predicted 1334
6 SASI_Hs01_00058525 predicted 856
7 SASI_Hs01_00058527 predicted 1574
8 SASI_Hs01_00058526 predicted 1357
9 SASI_Hs02_00304401 predicted 826
10 SASI_Hs01_00058529 predicted 632
11 SASI_Hs01_00058522 predicted 1646
12 SASI_Hs01_00058530 predicted 1270
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002138 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00333309 predicted 1373
2 SASI_Hs01_00121981 predicted 1498
3 SASI_Hs01_00121983 predicted 809
4 SASI_Hs01_00121984 predicted 1545
5 SASI_Hs01_00121988 predicted 1392
6 SASI_Hs01_00121985 predicted 905
7 SASI_Hs01_00121987 predicted 1629
8 SASI_Hs01_00121986 predicted 1419
9 SASI_Hs02_00333310 predicted 887
10 SASI_Hs01_00121989 predicted 693
11 SASI_Hs01_00121982 predicted 1711
12 SASI_Hs01_00121990 predicted 1332
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031369 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00358767 predicted 1466
2 SASI_Hs01_00102077 predicted 1594
3 SASI_Hs01_00102079 predicted 748
4 SASI_Hs01_00102080 predicted 1630
5 SASI_Hs01_00102084 predicted 1480
6 SASI_Hs01_00102081 predicted 855
7 SASI_Hs01_00102083 predicted 1719
8 SASI_Hs01_00102082 predicted 1506
9 SASI_Hs02_00358768 predicted 635
10 SASI_Hs01_00102085 predicted 1219
11 SASI_Hs01_00102078 predicted 1794
12 SASI_Hs01_00102086 predicted 1155
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031370 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00358769 predicted 1527
2 SASI_Hs01_00175900 predicted 1650
3 SASI_Hs01_00175902 predicted 803
4 SASI_Hs01_00175903 predicted 1689
5 SASI_Hs01_00175907 predicted 1538
6 SASI_Hs01_00175904 predicted 911
7 SASI_Hs01_00175906 predicted 1773
8 SASI_Hs01_00175905 predicted 1569
9 SASI_Hs02_00358770 predicted 692
10 SASI_Hs01_00175908 predicted 1279
11 SASI_Hs01_00175901 predicted 1858
12 SASI_Hs01_00175909 predicted 1212
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077265 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00292452 predicted 902
2 SASI_Mm02_00292453 predicted 659
3 SASI_Mm02_00292454 predicted 1272
4 SASI_Mm02_00292455 predicted 1295
5 SASI_Mm02_00292456 predicted 961
6 SASI_Mm02_00292457 predicted 1200
7 SASI_Mm02_00292458 predicted 1224
8 SASI_Mm02_00292459 predicted 1040
9 SASI_Mm02_00292460 predicted 1280
10 SASI_Mm02_00292461 predicted 1291
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077266 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00292462 predicted 845
2 SASI_Mm02_00292463 predicted 602
3 SASI_Mm02_00292464 predicted 1210
4 SASI_Mm02_00292465 predicted 1237
5 SASI_Mm02_00292466 predicted 910
6 SASI_Mm02_00292467 predicted 1145
7 SASI_Mm02_00292468 predicted 1171
8 SASI_Mm02_00292469 predicted 981
9 SASI_Mm02_00292470 predicted 1220
10 SASI_Mm02_00292471 predicted 1237
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077267 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00292472 predicted 847
2 SASI_Mm02_00292473 predicted 608
3 SASI_Mm02_00292474 predicted 960
4 SASI_Mm02_00292475 predicted 906
5 SASI_Mm02_00292476 predicted 619
6 SASI_Mm02_00292477 predicted 1106
7 SASI_Mm02_00292478 predicted 987
8 SASI_Mm02_00292479 predicted 1158
9 SASI_Mm02_00292480 predicted 877
10 SASI_Mm02_00292481 predicted 1157
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007516 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00196409 predicted 907
2 SASI_Mm02_00311818 predicted 663
3 SASI_Mm01_00196410 predicted 1015
4 SASI_Mm01_00196412 predicted 969
5 SASI_Mm01_00196414 predicted 675
6 SASI_Mm01_00196415 predicted 1161
7 SASI_Mm01_00196416 predicted 1038
8 SASI_Mm01_00196418 predicted 1216
9 SASI_Mm02_00311819 predicted 940
10 SASI_Mm02_00311820 predicted 1217
11 SASI_Mm01_00196411 predicted 534
12 SASI_Mm01_00196413 predicted 958
13 SASI_Mm01_00196417 predicted 911
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007516
VALIDATED
HNRNPD MISSION shRNA Bacterial Glycerol Stock
heterogeneous nuclear ribonucleoprotein D (AU-rich element RNA binding protein 1, 37kDa)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000324423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007516.2-757s21c1
Sequence:CCGGCGGAGAGTGTAGATAAGGTCACTCGAGTGACCTTATCTACACTCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007516.2-644s21c1
Sequence:CCGGGAAAGATCTGAAGGACTACTTCTCGAGAAGTAGTCCTTCAGATCTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007516.2-1174s21c1
Sequence:CCGGAGAGTGGTTATGGGAAAGTATCTCGAGATACTTTCCCATAACCACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324352    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007516.2-1361s21c1
Sequence:CCGGCCTGAATGGAAGTATGACGTTCTCGAGAACGTCATACTTCCATTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007516.2-1047s21c1
Sequence:CCGGCACAATGTTGGTCTTAGTAAACTCGAGTTTACTAAGACCAACATTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103735    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007516.1-1091s1c1
Sequence:CCGGCCTGAATGGAAGTATGACGTTCTCGAGAACGTCATACTTCCATTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007516.1-492s1c1
Sequence:CCGGCGGAGAGTGTAGATAAGGTCACTCGAGTGACCTTATCTACACTCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007516.1-379s1c1
Sequence:CCGGGAAAGATCTGAAGGACTACTTCTCGAGAAGTAGTCCTTCAGATCTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007516.1-782s1c1
Sequence:CCGGCACAATGTTGGTCTTAGTAAACTCGAGTTTACTAAGACCAACATTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007516.1-907s1c1
Sequence:CCGGAGAGTGGTTATGGGAAAGTATCTCGAGATACTTTCCCATAACCACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007516
VALIDATED
HNRNPD MISSION shRNA shRNA Plasmid DNA
heterogeneous nuclear ribonucleoprotein D (AU-rich element RNA binding protein 1, 37kDa)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000324423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007516.2-757s21c1
Sequence:CCGGCGGAGAGTGTAGATAAGGTCACTCGAGTGACCTTATCTACACTCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007516.2-644s21c1
Sequence:CCGGGAAAGATCTGAAGGACTACTTCTCGAGAAGTAGTCCTTCAGATCTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007516.2-1174s21c1
Sequence:CCGGAGAGTGGTTATGGGAAAGTATCTCGAGATACTTTCCCATAACCACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324352    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007516.2-1361s21c1
Sequence:CCGGCCTGAATGGAAGTATGACGTTCTCGAGAACGTCATACTTCCATTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007516.2-1047s21c1
Sequence:CCGGCACAATGTTGGTCTTAGTAAACTCGAGTTTACTAAGACCAACATTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103735    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007516.1-1091s1c1
Sequence:CCGGCCTGAATGGAAGTATGACGTTCTCGAGAACGTCATACTTCCATTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007516.1-492s1c1
Sequence:CCGGCGGAGAGTGTAGATAAGGTCACTCGAGTGACCTTATCTACACTCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007516.1-379s1c1
Sequence:CCGGGAAAGATCTGAAGGACTACTTCTCGAGAAGTAGTCCTTCAGATCTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007516.1-782s1c1
Sequence:CCGGCACAATGTTGGTCTTAGTAAACTCGAGTTTACTAAGACCAACATTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007516.1-907s1c1
Sequence:CCGGAGAGTGGTTATGGGAAAGTATCTCGAGATACTTTCCCATAACCACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007516
VALIDATED
HNRNPD MISSION shRNA Lentiviral Transduction Particles
heterogeneous nuclear ribonucleoprotein D (AU-rich element RNA binding protein 1, 37kDa)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000324423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007516.2-757s21c1
Sequence:CCGGCGGAGAGTGTAGATAAGGTCACTCGAGTGACCTTATCTACACTCTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007516.2-644s21c1
Sequence:CCGGGAAAGATCTGAAGGACTACTTCTCGAGAAGTAGTCCTTCAGATCTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007516.2-1174s21c1
Sequence:CCGGAGAGTGGTTATGGGAAAGTATCTCGAGATACTTTCCCATAACCACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324352    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007516.2-1361s21c1
Sequence:CCGGCCTGAATGGAAGTATGACGTTCTCGAGAACGTCATACTTCCATTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007516.2-1047s21c1
Sequence:CCGGCACAATGTTGGTCTTAGTAAACTCGAGTTTACTAAGACCAACATTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103735    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007516.1-1091s1c1
Sequence:CCGGCCTGAATGGAAGTATGACGTTCTCGAGAACGTCATACTTCCATTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007516.1-492s1c1
Sequence:CCGGCGGAGAGTGTAGATAAGGTCACTCGAGTGACCTTATCTACACTCTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007516.1-379s1c1
Sequence:CCGGGAAAGATCTGAAGGACTACTTCTCGAGAAGTAGTCCTTCAGATCTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007516.1-782s1c1
Sequence:CCGGCACAATGTTGGTCTTAGTAAACTCGAGTTTACTAAGACCAACATTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007516.1-907s1c1
Sequence:CCGGAGAGTGGTTATGGGAAAGTATCTCGAGATACTTTCCCATAACCACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031370
VALIDATED
HNRNPD MISSION shRNA Bacterial Glycerol Stock
heterogeneous nuclear ribonucleoprotein D (AU-rich element RNA binding protein 1, 37kDa)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000293284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_031370.2-1295s21c1
Sequence:CCGGACTATGGATATGGTGATTATACTCGAGTATAATCACCATATCCATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_031370.2-1093s21c1
Sequence:CCGGTCGAAGGAACAATATCAGCAACTCGAGTTGCTGATATTGTTCCTTCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293354    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031370.2-1826s21c1
Sequence:CCGGCCGAAATTGAGGACATGATTACTCGAGTAATCATGTCCTCAATTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_031370.2-1325s21c1
Sequence:CCGGAGAGTGGTTATGGGAAGGTATCTCGAGATACCTTCCCATAACCACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_031370.2-529s21c1
Sequence:CCGGAGTAAGAACGAGGAGGATGAACTCGAGTTCATCCTCCTCGTTCTTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001292    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031370.x-2119s1c1
Sequence:CCGGGCGGCTAGTTCAGAGAGATTTCTCGAGAAATCTCTCTGAACTAGCCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_031370.x-496s1c1
Sequence:CCGGAGTAAGAACGAGGAGGATGAACTCGAGTTCATCCTCCTCGTTCTTACTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_031370.x-1292s1c1
Sequence:CCGGAGAGTGGTTATGGGAAGGTATCTCGAGATACCTTCCCATAACCACTCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_031370.x-1233s1c1
Sequence:CCGGAGGATATGACTACACTGGTTACTCGAGTAACCAGTGTAGTCATATCCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_031370.x-1060s1c1
Sequence:CCGGTCGAAGGAACAATATCAGCAACTCGAGTTGCTGATATTGTTCCTTCGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031370
VALIDATED
HNRNPD MISSION shRNA shRNA Plasmid DNA
heterogeneous nuclear ribonucleoprotein D (AU-rich element RNA binding protein 1, 37kDa)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000293284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_031370.2-1295s21c1
Sequence:CCGGACTATGGATATGGTGATTATACTCGAGTATAATCACCATATCCATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_031370.2-1093s21c1
Sequence:CCGGTCGAAGGAACAATATCAGCAACTCGAGTTGCTGATATTGTTCCTTCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293354    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031370.2-1826s21c1
Sequence:CCGGCCGAAATTGAGGACATGATTACTCGAGTAATCATGTCCTCAATTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_031370.2-1325s21c1
Sequence:CCGGAGAGTGGTTATGGGAAGGTATCTCGAGATACCTTCCCATAACCACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_031370.2-529s21c1
Sequence:CCGGAGTAAGAACGAGGAGGATGAACTCGAGTTCATCCTCCTCGTTCTTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001292    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031370.x-2119s1c1
Sequence:CCGGGCGGCTAGTTCAGAGAGATTTCTCGAGAAATCTCTCTGAACTAGCCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_031370.x-496s1c1
Sequence:CCGGAGTAAGAACGAGGAGGATGAACTCGAGTTCATCCTCCTCGTTCTTACTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_031370.x-1292s1c1
Sequence:CCGGAGAGTGGTTATGGGAAGGTATCTCGAGATACCTTCCCATAACCACTCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_031370.x-1233s1c1
Sequence:CCGGAGGATATGACTACACTGGTTACTCGAGTAACCAGTGTAGTCATATCCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_031370.x-1060s1c1
Sequence:CCGGTCGAAGGAACAATATCAGCAACTCGAGTTGCTGATATTGTTCCTTCGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031370
VALIDATED
HNRNPD MISSION shRNA Lentiviral Transduction Particles
heterogeneous nuclear ribonucleoprotein D (AU-rich element RNA binding protein 1, 37kDa)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000293284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_031370.2-1295s21c1
Sequence:CCGGACTATGGATATGGTGATTATACTCGAGTATAATCACCATATCCATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_031370.2-1093s21c1
Sequence:CCGGTCGAAGGAACAATATCAGCAACTCGAGTTGCTGATATTGTTCCTTCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293354    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031370.2-1826s21c1
Sequence:CCGGCCGAAATTGAGGACATGATTACTCGAGTAATCATGTCCTCAATTTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_031370.2-1325s21c1
Sequence:CCGGAGAGTGGTTATGGGAAGGTATCTCGAGATACCTTCCCATAACCACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_031370.2-529s21c1
Sequence:CCGGAGTAAGAACGAGGAGGATGAACTCGAGTTCATCCTCCTCGTTCTTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001292    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031370.x-2119s1c1
Sequence:CCGGGCGGCTAGTTCAGAGAGATTTCTCGAGAAATCTCTCTGAACTAGCCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_031370.x-496s1c1
Sequence:CCGGAGTAAGAACGAGGAGGATGAACTCGAGTTCATCCTCCTCGTTCTTACTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_031370.x-1292s1c1
Sequence:CCGGAGAGTGGTTATGGGAAGGTATCTCGAGATACCTTCCCATAACCACTCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_031370.x-1233s1c1
Sequence:CCGGAGGATATGACTACACTGGTTACTCGAGTAACCAGTGTAGTCATATCCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_031370.x-1060s1c1
Sequence:CCGGTCGAAGGAACAATATCAGCAACTCGAGTTGCTGATATTGTTCCTTCGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)