EMAIL THIS PAGE TO A FRIEND

HNRNPDL

heterogeneous nuclear ribonucleoprotein D-like

171 Gene Product Result for
Synonyms: HNRNP HNRPDL JKTBP JKTBP2 laAUF1
Gene ID:
Human(9987) Summary: This gene belongs to the subfamily of ubiquitously expressed heterogeneous nuclear ribonucleoproteins (hnRNPs). The hnRNPs are RNA binding proteins and they complex with heterogeneous nuclear RNA (hnRNA). These proteins are associated with pre-mRNAs in the nucleus and appear to influence pre-mRNA processing and other aspects of mRNA metabolism and transport. While all of the hnRNPs are present in the nucleus, some seem to shuttle between the nucleus and the cytoplasm. The hnRNP proteins have distinct nucleic acid binding properties. The protein encoded by this gene has two RRM domains that bind to RNAs. Three alternatively spliced transcript variants have been described for this gene. One of the variants is probably not translated because the transcript is a candidate for nonsense-mediated mRNA decay. The protein isoforms encoded by this gene are similar to its family member HNRPD. [provided by RefSeq, May 2011]
Mouse(50926) heterogeneous nuclear ribonucleoprotein D-like
Rat(305178) heterogeneous nuclear ribonucleoprotein D-like
domestic guinea pig(100728088) heterogeneous nuclear ribonucleoprotein D-like
naked mole-rat(101723456) heterogeneous nuclear ribonucleoprotein D-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA056820 Anti-HNRNPDL antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
HPA063147 Anti-HNRNPDL antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB2108677 Anti-HNRPDL affinity isolated antibody human, guinea pig, bovine, dog, horse, rat, rabbit, mouse
western blot pricing
AV40585 Anti-HNRPDL antibody produced in rabbit IgG fraction of antiserum guinea pig, mouse, rat, human, bovine, horse, dog
immunohistochemistry, western blot pricing
SAB2101058 Anti-HNRPDL antibody produced in rabbit affinity isolated antibody rat, horse, zebrafish, bovine, rabbit, mouse, canine, human, guinea pig
western blot pricing
SAB4503750 Anti-HNRPDL antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031372 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031372 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031372 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016690 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016690 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016690 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005463 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005463 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005463 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU088491 MISSION® esiRNA esiRNA human HNRPDL (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005463 Rosetta Predictions human pricing
NM_031372 Rosetta Predictions human pricing
NR_003249 Rosetta Predictions human pricing
NM_001033696 Rosetta Predictions rat pricing
NM_016690 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005463 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00016526 predicted 927
2 SASI_Hs01_00016527 predicted 1426
3 SASI_Hs01_00016528 predicted 1643
4 SASI_Hs01_00016529 predicted 940
5 SASI_Hs01_00016530 predicted 1363
6 SASI_Hs01_00016531 predicted 1224
7 SASI_Hs01_00016532 predicted 982
8 SASI_Hs01_00016533 predicted 1471
9 SASI_Hs01_00016534 predicted 1227
10 SASI_Hs01_00016535 predicted 1621
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031372 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00358773 predicted 1772
2 SASI_Hs02_00358774 predicted 1669
3 SASI_Hs02_00358775 predicted 1686
4 SASI_Hs01_00123220 predicted 1375
5 SASI_Hs01_00123221 predicted 1600
6 SASI_Hs01_00123222 predicted 891
7 SASI_Hs01_00123223 predicted 1317
8 SASI_Hs01_00123224 predicted 1179
9 SASI_Hs02_00358776 predicted 1606
10 SASI_Hs01_00123225 predicted 940
11 SASI_Hs01_00123219 predicted 934
12 SASI_Hs01_00123226 predicted 1465
13 SASI_Hs01_00123227 predicted 1225
14 SASI_Hs01_00123228 predicted 1628
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_003249 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00378888 predicted 2684
2 SASI_Hs02_00378889 predicted 2265
3 SASI_Hs02_00378890 predicted 1779
4 SASI_Hs02_00378891 predicted 1683
5 SASI_Hs02_00378892 predicted 1372
6 SASI_Hs02_00378893 predicted 1815
7 SASI_Hs02_00378894 predicted 891
8 SASI_Hs02_00378895 predicted 1321
9 SASI_Hs02_00378896 predicted 2096
10 SASI_Hs02_00378897 predicted 2467
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033696 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00086465 predicted 983
2 SASI_Rn01_00086466 predicted 717
3 SASI_Rn01_00086467 predicted 1028
4 SASI_Rn01_00086468 predicted 968
5 SASI_Rn01_00086471 predicted 944
6 SASI_Rn01_00086472 predicted 633
7 SASI_Rn01_00086473 predicted 746
8 SASI_Rn01_00086474 predicted 767
9 SASI_Rn02_00203725 predicted 771
10 SASI_Rn02_00203726 predicted 725
11 SASI_Rn01_00086469 predicted 494
12 SASI_Rn01_00086470 predicted 741
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016690 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00095031 predicted 934
2 SASI_Mm01_00095033 predicted 1197
3 SASI_Mm01_00095034 predicted 620
4 SASI_Mm01_00095035 predicted 1126
5 SASI_Mm01_00095037 predicted 1295
6 SASI_Mm01_00095038 predicted 1183
7 SASI_Mm01_00095039 predicted 924
8 SASI_Mm02_00323350 predicted 307
9 SASI_Mm02_00323351 predicted 1242
10 SASI_Mm02_00323352 predicted 1195
11 SASI_Mm01_00095030 predicted 1020
12 SASI_Mm01_00095032 predicted 196
13 SASI_Mm01_00095036 predicted 576
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031372
VALIDATED
HNRNPDL MISSION shRNA Bacterial Glycerol Stock
heterogeneous nuclear ribonucleoprotein D-like
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000370671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031372.2-1126s21c1
Sequence:CCGGAGATGCTGCTAGTGTTGATAACTCGAGTTATCAACACTAGCAGCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_031372.2-1651s21c1
Sequence:CCGGTGGCTATGGCGGATATGATTACTCGAGTAATCATATCCGCCATAGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_031372.2-1054s21c1
Sequence:CCGGAGTTGTAGACTGCACAATTAACTCGAGTTAATTGTGCAGTCTACAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_031372.2-1029s21c1
Sequence:CCGGCAGAGTACTTGTCTCGATTTGCTCGAGCAAATCGAGACAAGTACTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236573    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031372.2-2373s21c1
Sequence:CCGGGCTTTCTAGTAGACCATATTTCTCGAGAAATATGGTCTACTAGAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370727    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031372.2-2224s21c1
Sequence:CCGGCTCCAATTTGTAGGTGTATTTCTCGAGAAATACACCTACAAATTGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370672    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031372.2-1865s21c1
Sequence:CCGGTTGGTCTTCTGTTGATCTAAGCTCGAGCTTAGATCAACAGAAGACCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031372.2-1260s21c1
Sequence:CCGGCGGATACTTCTGAAGAACAAACTCGAGTTTGTTCTTCAGAAGTATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_031372.2-1779s21c1
Sequence:CCGGACAATTACCAGCCATACTAAACTCGAGTTTAGTATGGCTGGTAATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031372
VALIDATED
HNRNPDL MISSION shRNA shRNA Plasmid DNA
heterogeneous nuclear ribonucleoprotein D-like
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000370671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031372.2-1126s21c1
Sequence:CCGGAGATGCTGCTAGTGTTGATAACTCGAGTTATCAACACTAGCAGCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_031372.2-1651s21c1
Sequence:CCGGTGGCTATGGCGGATATGATTACTCGAGTAATCATATCCGCCATAGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_031372.2-1054s21c1
Sequence:CCGGAGTTGTAGACTGCACAATTAACTCGAGTTAATTGTGCAGTCTACAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_031372.2-1029s21c1
Sequence:CCGGCAGAGTACTTGTCTCGATTTGCTCGAGCAAATCGAGACAAGTACTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236573    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031372.2-2373s21c1
Sequence:CCGGGCTTTCTAGTAGACCATATTTCTCGAGAAATATGGTCTACTAGAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370727    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031372.2-2224s21c1
Sequence:CCGGCTCCAATTTGTAGGTGTATTTCTCGAGAAATACACCTACAAATTGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370672    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031372.2-1865s21c1
Sequence:CCGGTTGGTCTTCTGTTGATCTAAGCTCGAGCTTAGATCAACAGAAGACCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031372.2-1260s21c1
Sequence:CCGGCGGATACTTCTGAAGAACAAACTCGAGTTTGTTCTTCAGAAGTATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_031372.2-1779s21c1
Sequence:CCGGACAATTACCAGCCATACTAAACTCGAGTTTAGTATGGCTGGTAATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031372
VALIDATED
HNRNPDL MISSION shRNA Lentiviral Transduction Particles
heterogeneous nuclear ribonucleoprotein D-like
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000370671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031372.2-1126s21c1
Sequence:CCGGAGATGCTGCTAGTGTTGATAACTCGAGTTATCAACACTAGCAGCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_031372.2-1651s21c1
Sequence:CCGGTGGCTATGGCGGATATGATTACTCGAGTAATCATATCCGCCATAGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_031372.2-1054s21c1
Sequence:CCGGAGTTGTAGACTGCACAATTAACTCGAGTTAATTGTGCAGTCTACAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_031372.2-1029s21c1
Sequence:CCGGCAGAGTACTTGTCTCGATTTGCTCGAGCAAATCGAGACAAGTACTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236573    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031372.2-2373s21c1
Sequence:CCGGGCTTTCTAGTAGACCATATTTCTCGAGAAATATGGTCTACTAGAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370727    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031372.2-2224s21c1
Sequence:CCGGCTCCAATTTGTAGGTGTATTTCTCGAGAAATACACCTACAAATTGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370672    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031372.2-1865s21c1
Sequence:CCGGTTGGTCTTCTGTTGATCTAAGCTCGAGCTTAGATCAACAGAAGACCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031372.2-1260s21c1
Sequence:CCGGCGGATACTTCTGAAGAACAAACTCGAGTTTGTTCTTCAGAAGTATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_031372.2-1779s21c1
Sequence:CCGGACAATTACCAGCCATACTAAACTCGAGTTTAGTATGGCTGGTAATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016690
VALIDATED
HNRNPDL MISSION shRNA Bacterial Glycerol Stock
heterogeneous nuclear ribonucleoprotein D-like
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000294677    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016690.4-1397s21c1
Sequence:CCGGTGTTGACCTAAGATGATTATTCTCGAGAATAATCATCTTAGGTCAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016690.4-913s21c2
Sequence:CCGGGAGCCAGTAAAGAAACTGTTACTCGAGTAACAGTTTCTTTACTGGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016690.4-1187s21c1
Sequence:CCGGGCTATGATTATACTGGGTATACTCGAGTATACCCAGTATAATCATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016690.4-1289s21c1
Sequence:CCGGGCGGCAATCACCAGAACAATTCTCGAGAATTGTTCTGGTGATTGCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016690.4-954s21c1
Sequence:CCGGAGGTTCTGGGAAGTGCGAAATCTCGAGATTTCGCACTTCCCAGAACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016690.2-957s1c1
Sequence:CCGGCCAGAACAATTACCAGCCCTACTCGAGTAGGGCTGGTAATTGTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103680    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016690.2-1500s1c1
Sequence:CCGGGCGTAAAGATTAAAGTGGAAACTCGAGTTTCCACTTTAATCTTTACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016690.2-571s1c1
Sequence:CCGGGAGCCAGTAAAGAAACTGTTACTCGAGTAACAGTTTCTTTACTGGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016690.2-947s1c1
Sequence:CCGGGCGGCAATCACCAGAACAATTCTCGAGAATTGTTCTGGTGATTGCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016690.2-845s1c1
Sequence:CCGGGCTATGATTATACTGGGTATACTCGAGTATACCCAGTATAATCATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016690
VALIDATED
HNRNPDL MISSION shRNA shRNA Plasmid DNA
heterogeneous nuclear ribonucleoprotein D-like
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000294677    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016690.4-1397s21c1
Sequence:CCGGTGTTGACCTAAGATGATTATTCTCGAGAATAATCATCTTAGGTCAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016690.4-913s21c2
Sequence:CCGGGAGCCAGTAAAGAAACTGTTACTCGAGTAACAGTTTCTTTACTGGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016690.4-1187s21c1
Sequence:CCGGGCTATGATTATACTGGGTATACTCGAGTATACCCAGTATAATCATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016690.4-1289s21c1
Sequence:CCGGGCGGCAATCACCAGAACAATTCTCGAGAATTGTTCTGGTGATTGCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016690.4-954s21c1
Sequence:CCGGAGGTTCTGGGAAGTGCGAAATCTCGAGATTTCGCACTTCCCAGAACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016690.2-957s1c1
Sequence:CCGGCCAGAACAATTACCAGCCCTACTCGAGTAGGGCTGGTAATTGTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103680    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016690.2-1500s1c1
Sequence:CCGGGCGTAAAGATTAAAGTGGAAACTCGAGTTTCCACTTTAATCTTTACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016690.2-571s1c1
Sequence:CCGGGAGCCAGTAAAGAAACTGTTACTCGAGTAACAGTTTCTTTACTGGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016690.2-947s1c1
Sequence:CCGGGCGGCAATCACCAGAACAATTCTCGAGAATTGTTCTGGTGATTGCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016690.2-845s1c1
Sequence:CCGGGCTATGATTATACTGGGTATACTCGAGTATACCCAGTATAATCATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016690
VALIDATED
HNRNPDL MISSION shRNA Lentiviral Transduction Particles
heterogeneous nuclear ribonucleoprotein D-like
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000294677    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016690.4-1397s21c1
Sequence:CCGGTGTTGACCTAAGATGATTATTCTCGAGAATAATCATCTTAGGTCAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016690.4-913s21c2
Sequence:CCGGGAGCCAGTAAAGAAACTGTTACTCGAGTAACAGTTTCTTTACTGGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016690.4-1187s21c1
Sequence:CCGGGCTATGATTATACTGGGTATACTCGAGTATACCCAGTATAATCATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016690.4-1289s21c1
Sequence:CCGGGCGGCAATCACCAGAACAATTCTCGAGAATTGTTCTGGTGATTGCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016690.4-954s21c1
Sequence:CCGGAGGTTCTGGGAAGTGCGAAATCTCGAGATTTCGCACTTCCCAGAACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016690.2-957s1c1
Sequence:CCGGCCAGAACAATTACCAGCCCTACTCGAGTAGGGCTGGTAATTGTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103680    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016690.2-1500s1c1
Sequence:CCGGGCGTAAAGATTAAAGTGGAAACTCGAGTTTCCACTTTAATCTTTACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016690.2-571s1c1
Sequence:CCGGGAGCCAGTAAAGAAACTGTTACTCGAGTAACAGTTTCTTTACTGGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016690.2-947s1c1
Sequence:CCGGGCGGCAATCACCAGAACAATTCTCGAGAATTGTTCTGGTGATTGCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016690.2-845s1c1
Sequence:CCGGGCTATGATTATACTGGGTATACTCGAGTATACCCAGTATAATCATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005463
VALIDATED
HNRNPDL MISSION shRNA Bacterial Glycerol Stock
heterogeneous nuclear ribonucleoprotein D-like
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000074553    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_005463.2-2201s1c1
Sequence:CCGGCCTCAAATAAATGCTTCCTTACTCGAGTAAGGAAGCATTTATTTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_005463.2-1305s1c1
Sequence:CCGGCGGATACTTCTGAAGAACAAACTCGAGTTTGTTCTTCAGAAGTATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005463.2-1705s1c1
Sequence:CCGGCGGATATGATTATACTGGGTACTCGAGTACCCAGTATAATCATATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005463.2-1465s1c1
Sequence:CCGGCCATCAAATTGGTTCTGGGAACTCGAGTTCCCAGAACCAATTTGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005463.2-931s1c1
Sequence:CCGGCGTCACTATGGAGGATATGAACTCGAGTTCATATCCTCCATAGTGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005463
VALIDATED
HNRNPDL MISSION shRNA shRNA Plasmid DNA
heterogeneous nuclear ribonucleoprotein D-like
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000074553    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_005463.2-2201s1c1
Sequence:CCGGCCTCAAATAAATGCTTCCTTACTCGAGTAAGGAAGCATTTATTTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_005463.2-1305s1c1
Sequence:CCGGCGGATACTTCTGAAGAACAAACTCGAGTTTGTTCTTCAGAAGTATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005463.2-1705s1c1
Sequence:CCGGCGGATATGATTATACTGGGTACTCGAGTACCCAGTATAATCATATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005463.2-1465s1c1
Sequence:CCGGCCATCAAATTGGTTCTGGGAACTCGAGTTCCCAGAACCAATTTGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005463.2-931s1c1
Sequence:CCGGCGTCACTATGGAGGATATGAACTCGAGTTCATATCCTCCATAGTGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005463
VALIDATED
HNRNPDL MISSION shRNA Lentiviral Transduction Particles
heterogeneous nuclear ribonucleoprotein D-like
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000074553    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_005463.2-2201s1c1
Sequence:CCGGCCTCAAATAAATGCTTCCTTACTCGAGTAAGGAAGCATTTATTTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_005463.2-1305s1c1
Sequence:CCGGCGGATACTTCTGAAGAACAAACTCGAGTTTGTTCTTCAGAAGTATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005463.2-1705s1c1
Sequence:CCGGCGGATATGATTATACTGGGTACTCGAGTACCCAGTATAATCATATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005463.2-1465s1c1
Sequence:CCGGCCATCAAATTGGTTCTGGGAACTCGAGTTCCCAGAACCAATTTGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005463.2-931s1c1
Sequence:CCGGCGTCACTATGGAGGATATGAACTCGAGTTCATATCCTCCATAGTGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)