EMAIL THIS PAGE TO A FRIEND

HNRNPF

heterogeneous nuclear ribonucleoprotein F

199 Gene Product Result for
Synonyms: HNRPF OK/SW-cl.23 mcs94-1
UniProtKB ID: P52597, B3KM84, Q5T0N2, Q96AU2
Gene ID:
Human(3185) Summary: This gene belongs to the subfamily of ubiquitously expressed heterogeneous nuclear ribonucleoproteins (hnRNPs). The hnRNPs are RNA binding proteins that complex with heterogeneous nuclear RNA (hnRNA). These proteins are associated with pre-mRNAs in the nucleus and regulate alternative splicing, polyadenylation, and other aspects of mRNA metabolism and transport. While all of the hnRNPs are present in the nucleus, some seem to shuttle between the nucleus and the cytoplasm. The hnRNP proteins have distinct nucleic acid binding properties. The protein encoded by this gene has three repeats of quasi-RRM domains that bind to RNAs which have guanosine-rich sequences. This protein is very similar to the family member hnRPH. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Jul 2008]
Mouse(98758) heterogeneous nuclear ribonucleoprotein F
Rat(64200) heterogeneous nuclear ribonucleoprotein F
cow(506917) heterogeneous nuclear ribonucleoprotein F
dog(477757) heterogeneous nuclear ribonucleoprotein F
domestic cat(101099752) heterogeneous nuclear ribonucleoprotein F
sheep(101118755) heterogeneous nuclear ribonucleoprotein F
domestic guinea pig(100718094) heterogeneous nuclear ribonucleoprotein F
naked mole-rat(101721022) heterogeneous nuclear ribonucleoprotein F
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133834 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133834 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133834 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004966 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004966 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004966 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001098204 Rosetta Predictions human pricing
NM_001098205 Rosetta Predictions human pricing
NM_001098206 Rosetta Predictions human pricing
NM_001098207 Rosetta Predictions human pricing
NM_001098208 Rosetta Predictions human pricing
NM_004966 Rosetta Predictions human pricing
NM_001037285 Rosetta Predictions rat pricing
NM_001037286 Rosetta Predictions rat pricing
NM_001037287 Rosetta Predictions rat pricing
NM_022397 Rosetta Predictions rat pricing
NM_133834 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098204 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00318648 predicted 1007
2 SASI_Hs02_00318649 predicted 1405
3 SASI_Hs02_00318650 predicted 430
4 SASI_Hs02_00318651 predicted 604
5 SASI_Hs02_00318652 predicted 583
6 SASI_Hs02_00318653 predicted 952
7 SASI_Hs02_00318654 predicted 1317
8 SASI_Hs02_00318655 predicted 850
9 SASI_Hs02_00318656 predicted 927
10 SASI_Hs02_00318657 predicted 485
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098205 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00318658 predicted 1054
2 SASI_Hs02_00318659 predicted 1453
3 SASI_Hs02_00318660 predicted 465
4 SASI_Hs02_00318661 predicted 637
5 SASI_Hs02_00318662 predicted 627
6 SASI_Hs02_00318663 predicted 989
7 SASI_Hs02_00318664 predicted 1356
8 SASI_Hs02_00318665 predicted 889
9 SASI_Hs02_00318666 predicted 969
10 SASI_Hs02_00318667 predicted 530
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098206 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00318668 predicted 1027
2 SASI_Hs02_00318669 predicted 1428
3 SASI_Hs02_00318670 predicted 440
4 SASI_Hs02_00318671 predicted 613
5 SASI_Hs02_00318672 predicted 601
6 SASI_Hs02_00318673 predicted 967
7 SASI_Hs02_00318674 predicted 1332
8 SASI_Hs02_00318675 predicted 865
9 SASI_Hs02_00318676 predicted 938
10 SASI_Hs02_00318677 predicted 509
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098207 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00318678 predicted 1052
2 SASI_Hs02_00318679 predicted 1448
3 SASI_Hs02_00318680 predicted 470
4 SASI_Hs02_00318681 predicted 649
5 SASI_Hs02_00318682 predicted 625
6 SASI_Hs02_00318683 predicted 1000
7 SASI_Hs02_00318684 predicted 1359
8 SASI_Hs02_00318685 predicted 897
9 SASI_Hs02_00318686 predicted 974
10 SASI_Hs02_00318687 predicted 527
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098208 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00318688 predicted 1130
2 SASI_Hs02_00318689 predicted 1528
3 SASI_Hs02_00318690 predicted 547
4 SASI_Hs02_00318691 predicted 721
5 SASI_Hs02_00318692 predicted 703
6 SASI_Hs02_00318693 predicted 1076
7 SASI_Hs02_00318694 predicted 1443
8 SASI_Hs02_00318695 predicted 971
9 SASI_Hs02_00318696 predicted 1050
10 SASI_Hs02_00318697 predicted 608
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004966 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00033408 predicted 1012
2 SASI_Hs01_00033409 predicted 1408
3 SASI_Hs02_00338663 predicted 429
4 SASI_Hs01_00033410 predicted 605
5 SASI_Hs01_00033412 predicted 587
6 SASI_Hs01_00033414 predicted 949
7 SASI_Hs01_00033415 predicted 1318
8 SASI_Hs01_00033416 predicted 851
9 SASI_Hs01_00033417 predicted 925
10 SASI_Hs02_00338664 predicted 488
11 SASI_Hs01_00033411 predicted 1130
12 SASI_Hs01_00033413 predicted 571
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037285 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00106137 predicted 1576
2 SASI_Rn02_00204356 predicted 852
3 SASI_Rn01_00106138 predicted 1368
4 SASI_Rn01_00106140 predicted 1386
5 SASI_Rn01_00106141 predicted 888
6 SASI_Rn01_00106142 predicted 1615
7 SASI_Rn01_00106143 predicted 1091
8 SASI_Rn01_00106144 predicted 670
9 SASI_Rn01_00106145 predicted 1123
10 SASI_Rn01_00106146 predicted 808
11 SASI_Rn01_00106139 predicted 1283
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037286 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00105127 predicted 1618
2 SASI_Rn02_00204357 predicted 898
3 SASI_Rn01_00105128 predicted 1407
4 SASI_Rn01_00105130 predicted 1429
5 SASI_Rn01_00105131 predicted 930
6 SASI_Rn01_00105132 predicted 1654
7 SASI_Rn01_00105133 predicted 1135
8 SASI_Rn01_00105134 predicted 714
9 SASI_Rn01_00105135 predicted 1171
10 SASI_Rn01_00105136 predicted 847
11 SASI_Rn01_00105129 predicted 1319
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037287 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00056079 predicted 1535
2 SASI_Rn02_00204358 predicted 806
3 SASI_Rn01_00056080 predicted 1323
4 SASI_Rn01_00056082 predicted 1348
5 SASI_Rn01_00056083 predicted 838
6 SASI_Rn01_00056084 predicted 1567
7 SASI_Rn01_00056085 predicted 1051
8 SASI_Rn01_00056086 predicted 632
9 SASI_Rn01_00056087 predicted 1080
10 SASI_Rn01_00056088 predicted 761
11 SASI_Rn01_00056081 predicted 1240
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022397 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00032400 predicted 1545
2 SASI_Rn02_00263166 predicted 823
3 SASI_Rn01_00032401 predicted 1339
4 SASI_Rn01_00032403 predicted 1358
5 SASI_Rn01_00032404 predicted 850
6 SASI_Rn01_00032405 predicted 1583
7 SASI_Rn01_00032406 predicted 1064
8 SASI_Rn01_00032407 predicted 647
9 SASI_Rn01_00032408 predicted 1094
10 SASI_Rn01_00032409 predicted 773
11 SASI_Rn01_00032402 predicted 1255
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133834 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00338864 predicted 1233
2 SASI_Mm01_00130651 predicted 803
3 SASI_Mm02_00338865 predicted 861
4 SASI_Mm02_00338866 predicted 1045
5 SASI_Mm02_00338867 predicted 741
6 SASI_Mm02_00338868 predicted 840
7 SASI_Mm02_00338869 predicted 1228
8 SASI_Mm01_00130652 predicted 941
9 SASI_Mm01_00130653 predicted 758
10 SASI_Mm02_00338870 predicted 625
11 SASI_Mm01_00130654 predicted 1179
12 SASI_Mm01_00130655 predicted 1320
13 SASI_Mm01_00130656 predicted 1534
14 SASI_Mm01_00130657 predicted 511
15 SASI_Mm01_00130658 predicted 1512
16 SASI_Mm01_00130659 predicted 1350
17 SASI_Mm01_00130660 predicted 773
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133834
VALIDATED
HNRNPF MISSION shRNA Bacterial Glycerol Stock
heterogeneous nuclear ribonucleoprotein F
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000351669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133834.1-395s21c2
Sequence:CCGGGCAGGTGTTCATTTCATTTATCTCGAGATAAATGAAATGAACACCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133834.1-1171s21c1
Sequence:CCGGAGCAACGGAGAACGACATTTACTCGAGTAAATGTCGTTCTCCGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305483    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133834.1-1800s21c1
Sequence:CCGGAGTATGTTGAGTGGATCTTTACTCGAGTAAAGATCCACTCAACATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133834.1-503s21c1
Sequence:CCGGAGCATGGGACACCGGTATATTCTCGAGAATATACCGGTGTCCCATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133834.1-339s21c1
Sequence:CCGGGCTCAATTGAGGACGTACAAACTCGAGTTTGTACGTCCTCAATTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109260    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133834.1-1619s1c1
Sequence:CCGGCCCACTTTGCACCATGAGTTTCTCGAGAAACTCATGGTGCAAAGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133834.1-629s1c1
Sequence:CCGGCCATTTGGATGCACAAAGGAACTCGAGTTCCTTTGTGCATCCAAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133834.1-338s1c1
Sequence:CCGGTGCTCAATTGAGGACGTACAACTCGAGTTGTACGTCCTCAATTGAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133834.1-395s1c1
Sequence:CCGGGCAGGTGTTCATTTCATTTATCTCGAGATAAATGAAATGAACACCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133834.1-339s1c1
Sequence:CCGGGCTCAATTGAGGACGTACAAACTCGAGTTTGTACGTCCTCAATTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133834
VALIDATED
HNRNPF MISSION shRNA shRNA Plasmid DNA
heterogeneous nuclear ribonucleoprotein F
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000351669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133834.1-395s21c2
Sequence:CCGGGCAGGTGTTCATTTCATTTATCTCGAGATAAATGAAATGAACACCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133834.1-1171s21c1
Sequence:CCGGAGCAACGGAGAACGACATTTACTCGAGTAAATGTCGTTCTCCGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305483    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133834.1-1800s21c1
Sequence:CCGGAGTATGTTGAGTGGATCTTTACTCGAGTAAAGATCCACTCAACATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133834.1-503s21c1
Sequence:CCGGAGCATGGGACACCGGTATATTCTCGAGAATATACCGGTGTCCCATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133834.1-339s21c1
Sequence:CCGGGCTCAATTGAGGACGTACAAACTCGAGTTTGTACGTCCTCAATTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109260    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133834.1-1619s1c1
Sequence:CCGGCCCACTTTGCACCATGAGTTTCTCGAGAAACTCATGGTGCAAAGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133834.1-629s1c1
Sequence:CCGGCCATTTGGATGCACAAAGGAACTCGAGTTCCTTTGTGCATCCAAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133834.1-338s1c1
Sequence:CCGGTGCTCAATTGAGGACGTACAACTCGAGTTGTACGTCCTCAATTGAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133834.1-395s1c1
Sequence:CCGGGCAGGTGTTCATTTCATTTATCTCGAGATAAATGAAATGAACACCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133834.1-339s1c1
Sequence:CCGGGCTCAATTGAGGACGTACAAACTCGAGTTTGTACGTCCTCAATTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133834
VALIDATED
HNRNPF MISSION shRNA Lentiviral Transduction Particles
heterogeneous nuclear ribonucleoprotein F
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000351669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133834.1-395s21c2
Sequence:CCGGGCAGGTGTTCATTTCATTTATCTCGAGATAAATGAAATGAACACCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133834.1-1171s21c1
Sequence:CCGGAGCAACGGAGAACGACATTTACTCGAGTAAATGTCGTTCTCCGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305483    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133834.1-1800s21c1
Sequence:CCGGAGTATGTTGAGTGGATCTTTACTCGAGTAAAGATCCACTCAACATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133834.1-503s21c1
Sequence:CCGGAGCATGGGACACCGGTATATTCTCGAGAATATACCGGTGTCCCATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133834.1-339s21c1
Sequence:CCGGGCTCAATTGAGGACGTACAAACTCGAGTTTGTACGTCCTCAATTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109260    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133834.1-1619s1c1
Sequence:CCGGCCCACTTTGCACCATGAGTTTCTCGAGAAACTCATGGTGCAAAGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133834.1-629s1c1
Sequence:CCGGCCATTTGGATGCACAAAGGAACTCGAGTTCCTTTGTGCATCCAAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133834.1-338s1c1
Sequence:CCGGTGCTCAATTGAGGACGTACAACTCGAGTTGTACGTCCTCAATTGAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133834.1-395s1c1
Sequence:CCGGGCAGGTGTTCATTTCATTTATCTCGAGATAAATGAAATGAACACCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133834.1-339s1c1
Sequence:CCGGGCTCAATTGAGGACGTACAAACTCGAGTTTGTACGTCCTCAATTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004966
VALIDATED
HNRNPF MISSION shRNA Bacterial Glycerol Stock
heterogeneous nuclear ribonucleoprotein F
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_004966.3-1415s21c1
Sequence:GTACCGGCAATATGCAGCACAGATATATCTCGAGATATATCTGTGCTGCATATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230711    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_004966.3-1666s21c1
Sequence:CCGGGCAATTAAGAGCAGTTATAATCTCGAGATTATAACTGCTCTTAATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_004966.3-1262s21c1
Sequence:CCGGAGCGACCGAGAACGACATTTACTCGAGTAAATGTCGTTCTCGGTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004966.3-898s21c1
Sequence:CCGGACAGGTACATTGAGGTGTTTACTCGAGTAAACACCTCAATGTACCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_004966.3-548s21c1
Sequence:CCGGTGGATCAGAAGATGATGTAAACTCGAGTTTACATCATCTTCTGATCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001233    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004966.x-2191s1c1
Sequence:CCGGTGGCACAGATTACTCAGCAAACTCGAGTTTGCTGAGTAATCTGTGCCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_004966.x-1226s1c1
Sequence:CCGGCGAGAACGACATTTACAACTTCTCGAGAAGTTGTAAATGTCGTTCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_004966.x-443s1c1
Sequence:CCGGCGCAGGTGTCCATTTCATCTACTCGAGTAGATGAAATGGACACCTGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_004966.x-821s1c1
Sequence:CCGGGAAGGCTCTAGGGAAACACAACTCGAGTTGTGTTTCCCTAGAGCCTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_004966.x-974s1c1
Sequence:CCGGGAGGTACATTGGCATCGTGAACTCGAGTTCACGATGCCAATGTACCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004966
VALIDATED
HNRNPF MISSION shRNA shRNA Plasmid DNA
heterogeneous nuclear ribonucleoprotein F
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_004966.3-1415s21c1
Sequence:GTACCGGCAATATGCAGCACAGATATATCTCGAGATATATCTGTGCTGCATATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230711    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_004966.3-1666s21c1
Sequence:CCGGGCAATTAAGAGCAGTTATAATCTCGAGATTATAACTGCTCTTAATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_004966.3-1262s21c1
Sequence:CCGGAGCGACCGAGAACGACATTTACTCGAGTAAATGTCGTTCTCGGTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004966.3-898s21c1
Sequence:CCGGACAGGTACATTGAGGTGTTTACTCGAGTAAACACCTCAATGTACCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_004966.3-548s21c1
Sequence:CCGGTGGATCAGAAGATGATGTAAACTCGAGTTTACATCATCTTCTGATCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001233    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004966.x-2191s1c1
Sequence:CCGGTGGCACAGATTACTCAGCAAACTCGAGTTTGCTGAGTAATCTGTGCCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_004966.x-1226s1c1
Sequence:CCGGCGAGAACGACATTTACAACTTCTCGAGAAGTTGTAAATGTCGTTCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_004966.x-443s1c1
Sequence:CCGGCGCAGGTGTCCATTTCATCTACTCGAGTAGATGAAATGGACACCTGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_004966.x-821s1c1
Sequence:CCGGGAAGGCTCTAGGGAAACACAACTCGAGTTGTGTTTCCCTAGAGCCTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_004966.x-974s1c1
Sequence:CCGGGAGGTACATTGGCATCGTGAACTCGAGTTCACGATGCCAATGTACCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004966
VALIDATED
HNRNPF MISSION shRNA Lentiviral Transduction Particles
heterogeneous nuclear ribonucleoprotein F
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_004966.3-1415s21c1
Sequence:GTACCGGCAATATGCAGCACAGATATATCTCGAGATATATCTGTGCTGCATATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230711    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_004966.3-1666s21c1
Sequence:CCGGGCAATTAAGAGCAGTTATAATCTCGAGATTATAACTGCTCTTAATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_004966.3-1262s21c1
Sequence:CCGGAGCGACCGAGAACGACATTTACTCGAGTAAATGTCGTTCTCGGTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004966.3-898s21c1
Sequence:CCGGACAGGTACATTGAGGTGTTTACTCGAGTAAACACCTCAATGTACCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_004966.3-548s21c1
Sequence:CCGGTGGATCAGAAGATGATGTAAACTCGAGTTTACATCATCTTCTGATCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001233    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004966.x-2191s1c1
Sequence:CCGGTGGCACAGATTACTCAGCAAACTCGAGTTTGCTGAGTAATCTGTGCCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_004966.x-1226s1c1
Sequence:CCGGCGAGAACGACATTTACAACTTCTCGAGAAGTTGTAAATGTCGTTCTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_004966.x-443s1c1
Sequence:CCGGCGCAGGTGTCCATTTCATCTACTCGAGTAGATGAAATGGACACCTGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_004966.x-821s1c1
Sequence:CCGGGAAGGCTCTAGGGAAACACAACTCGAGTTGTGTTTCCCTAGAGCCTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_004966.x-974s1c1
Sequence:CCGGGAGGTACATTGGCATCGTGAACTCGAGTTCACGATGCCAATGTACCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)