EMAIL THIS PAGE TO A FRIEND

HNRNPH1

heterogeneous nuclear ribonucleoprotein H1 (H)

104 Gene Product Result for
Synonyms: HNRPH HNRPH1 hnRNPH
UniProtKB ID: P31943, B3KW86, D3DWQ2, Q6IBM4
Gene ID:
Human(3187) Summary: This gene encodes a member of a subfamily of ubiquitously expressed heterogeneous nuclear ribonucleoproteins (hnRNPs). The hnRNPs are RNA binding proteins that complex with heterogeneous nuclear RNA. These proteins are associated with pre-mRNAs in the nucleus and appear to influence pre-mRNA processing and other aspects of mRNA metabolism and transport. While all of the hnRNPs are present in the nucleus, some may shuttle between the nucleus and the cytoplasm. The hnRNP proteins have distinct nucleic acid binding properties. The protein encoded by this gene has three repeats of quasi-RRM domains that bind to RNA and is very similar to the family member HNRPF. This gene may be associated with hereditary lymphedema type I. Alternatively spliced transcript variants have been described [provided by RefSeq, Mar 2012]
Mouse(59013) heterogeneous nuclear ribonucleoprotein H1
Rat(140931) heterogeneous nuclear ribonucleoprotein H1
Zebrafish(402984) heterogeneous nuclear ribonucleoprotein H1
chicken(395157) heterogeneous nuclear ribonucleoprotein H1 (H)
cow(541202) heterogeneous nuclear ribonucleoprotein H1 (H)
Horse(100067495) heterogeneous nuclear ribonucleoprotein H1 (H)
domestic cat(101086113) heterogeneous nuclear ribonucleoprotein H1 (H)
dog(481455) heterogeneous nuclear ribonucleoprotein H1 (H)
domestic guinea pig(100726512) heterogeneous nuclear ribonucleoprotein H1 (H)
naked mole-rat(101720219) heterogeneous nuclear ribonucleoprotein H1 (H)
sheep(101122518) heterogeneous nuclear ribonucleoprotein H1 (H)
Domestic Rabbit(100341383) heterogeneous nuclear ribonucleoprotein H1 (H)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021510 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021510 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021510 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005520 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005520 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005520 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005520 Rosetta Predictions human pricing
NM_080896 Rosetta Predictions rat pricing
NM_021510 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005520 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00113607 predicted 448
2 SASI_Hs01_00113609 predicted 644
3 SASI_Hs01_00113610 predicted 407
4 SASI_Hs01_00113611 predicted 1248
5 SASI_Hs01_00113612 predicted 407
6 SASI_Hs01_00113613 predicted 709
7 SASI_Hs01_00113615 predicted 452
8 SASI_Hs01_00113616 predicted 531
9 SASI_Hs02_00339736 predicted 366
10 SASI_Hs02_00339737 predicted 660
11 SASI_Hs01_00113608 predicted 337
12 SASI_Hs01_00113614 predicted 672
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080896 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00267349 predicted 1474
2 SASI_Rn01_00112467 predicted 1203
3 SASI_Rn01_00112468 predicted 1377
4 SASI_Rn01_00112469 predicted 1007
5 SASI_Rn01_00112471 predicted 1432
6 SASI_Rn01_00112472 predicted 1040
7 SASI_Rn01_00112473 predicted 531
8 SASI_Rn01_00112474 predicted 1487
9 SASI_Rn01_00112475 predicted 1228
10 SASI_Rn01_00112476 predicted 1438
11 SASI_Rn01_00112470 predicted 373
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021510 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00185296 predicted 450
2 SASI_Mm01_00185299 predicted 652
3 SASI_Mm02_00326228 predicted 241
4 SASI_Mm02_00326229 predicted 1319
5 SASI_Mm01_00185300 predicted 310
6 SASI_Mm01_00185301 predicted 815
7 SASI_Mm01_00185302 predicted 413
8 SASI_Mm01_00185303 predicted 695
9 SASI_Mm02_00326230 predicted 537
10 SASI_Mm02_00326231 predicted 373
11 SASI_Mm01_00185294 predicted 1444
12 SASI_Mm01_00185295 predicted 1448
13 SASI_Mm01_00185297 predicted 342
14 SASI_Mm01_00185298 predicted 1254
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021510
VALIDATED
HNRNPH1 MISSION shRNA Bacterial Glycerol Stock
heterogeneous nuclear ribonucleoprotein H1 (H)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000109110    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021510.1-1912s1c1
Sequence:CCGGGCGTCTACAATTAAAGTGATACTCGAGTATCACTTTAATTGTAGACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021510.1-837s1c1
Sequence:CCGGGCTATGGATTTGGTTCAGATACTCGAGTATCTGAACCAAATCCATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021510.1-1193s1c1
Sequence:CCGGGCTTACGAACACAGATATGTACTCGAGTACATATCTGTGTTCGTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021510.1-921s1c1
Sequence:CCGGGCTCTACTTTCCAGAGTACAACTCGAGTTGTACTCTGGAAAGTAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021510.1-647s1c1
Sequence:CCGGGCTGAAGTTAGAACTCATTATCTCGAGATAATGAGTTCTAACTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309170    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021510.2-1954s21c1
Sequence:CCGGGCGTCTACAATTAAAGTGATACTCGAGTATCACTTTAATTGTAGACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021510.2-1235s21c1
Sequence:CCGGGCTTACGAACACAGATATGTACTCGAGTACATATCTGTGTTCGTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021510.2-963s21c1
Sequence:CCGGGCTCTACTTTCCAGAGTACAACTCGAGTTGTACTCTGGAAAGTAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021510.2-689s21c1
Sequence:CCGGGCTGAAGTTAGAACTCATTATCTCGAGATAATGAGTTCTAACTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021510
VALIDATED
HNRNPH1 MISSION shRNA shRNA Plasmid DNA
heterogeneous nuclear ribonucleoprotein H1 (H)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000109110    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021510.1-1912s1c1
Sequence:CCGGGCGTCTACAATTAAAGTGATACTCGAGTATCACTTTAATTGTAGACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021510.1-837s1c1
Sequence:CCGGGCTATGGATTTGGTTCAGATACTCGAGTATCTGAACCAAATCCATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021510.1-1193s1c1
Sequence:CCGGGCTTACGAACACAGATATGTACTCGAGTACATATCTGTGTTCGTAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021510.1-921s1c1
Sequence:CCGGGCTCTACTTTCCAGAGTACAACTCGAGTTGTACTCTGGAAAGTAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021510.1-647s1c1
Sequence:CCGGGCTGAAGTTAGAACTCATTATCTCGAGATAATGAGTTCTAACTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309170    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021510.2-1954s21c1
Sequence:CCGGGCGTCTACAATTAAAGTGATACTCGAGTATCACTTTAATTGTAGACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021510.2-1235s21c1
Sequence:CCGGGCTTACGAACACAGATATGTACTCGAGTACATATCTGTGTTCGTAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021510.2-963s21c1
Sequence:CCGGGCTCTACTTTCCAGAGTACAACTCGAGTTGTACTCTGGAAAGTAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021510.2-689s21c1
Sequence:CCGGGCTGAAGTTAGAACTCATTATCTCGAGATAATGAGTTCTAACTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021510
VALIDATED
HNRNPH1 MISSION shRNA Lentiviral Transduction Particles
heterogeneous nuclear ribonucleoprotein H1 (H)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000109110    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021510.1-1912s1c1
Sequence:CCGGGCGTCTACAATTAAAGTGATACTCGAGTATCACTTTAATTGTAGACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021510.1-837s1c1
Sequence:CCGGGCTATGGATTTGGTTCAGATACTCGAGTATCTGAACCAAATCCATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021510.1-1193s1c1
Sequence:CCGGGCTTACGAACACAGATATGTACTCGAGTACATATCTGTGTTCGTAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021510.1-921s1c1
Sequence:CCGGGCTCTACTTTCCAGAGTACAACTCGAGTTGTACTCTGGAAAGTAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021510.1-647s1c1
Sequence:CCGGGCTGAAGTTAGAACTCATTATCTCGAGATAATGAGTTCTAACTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309170    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021510.2-1954s21c1
Sequence:CCGGGCGTCTACAATTAAAGTGATACTCGAGTATCACTTTAATTGTAGACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021510.2-1235s21c1
Sequence:CCGGGCTTACGAACACAGATATGTACTCGAGTACATATCTGTGTTCGTAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021510.2-963s21c1
Sequence:CCGGGCTCTACTTTCCAGAGTACAACTCGAGTTGTACTCTGGAAAGTAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021510.2-689s21c1
Sequence:CCGGGCTGAAGTTAGAACTCATTATCTCGAGATAATGAGTTCTAACTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005520
VALIDATED
HNRNPH1 MISSION shRNA Bacterial Glycerol Stock
heterogeneous nuclear ribonucleoprotein H1 (H)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000074593    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005520.1-1885s1c1
Sequence:CCGGGCATGTTGAAAGACATGCTTTCTCGAGAAAGCATGTCTTTCAACATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005520.1-911s1c1
Sequence:CCGGGCTCTACTTTCCAGAGCACAACTCGAGTTGTGCTCTGGAAAGTAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_005520.1-1012s1c1
Sequence:CCGGCCTGTGAGAGTACACATTGAACTCGAGTTCAATGTGTACTCTCACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005520.1-268s1c1
Sequence:CCGGGAAGTCAAATTGGCCCTGAAACTCGAGTTTCAGGGCCAATTTGACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_005520.1-650s1c1
Sequence:CCGGCTCATTATGATCCACCACGAACTCGAGTTCGTGGTGGATCATAATGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236086    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_005520.2-1895s21c1
Sequence:CCGGTTGCCCTTTGCCACGTTAAATCTCGAGATTTAACGTGGCAAAGGGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_005520.2-375s21c1
Sequence:CCGGCAAGTCAAACAACGTTGAAATCTCGAGATTTCAACGTTGTTTGACTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005520.2-847s21c1
Sequence:CCGGGATGATTACAATGGCTATAATCTCGAGATTATAGCCATTGTAATCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_005520.2-681s21c1
Sequence:CCGGAGCTGAAGTTAGAACTCATTACTCGAGTAATGAGTTCTAACTTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_005520.2-703s21c1
Sequence:CCGGGATCCACCACGAAAGCTTATGCTCGAGCATAAGCTTTCGTGGTGGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005520
VALIDATED
HNRNPH1 MISSION shRNA shRNA Plasmid DNA
heterogeneous nuclear ribonucleoprotein H1 (H)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000074593    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005520.1-1885s1c1
Sequence:CCGGGCATGTTGAAAGACATGCTTTCTCGAGAAAGCATGTCTTTCAACATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005520.1-911s1c1
Sequence:CCGGGCTCTACTTTCCAGAGCACAACTCGAGTTGTGCTCTGGAAAGTAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_005520.1-1012s1c1
Sequence:CCGGCCTGTGAGAGTACACATTGAACTCGAGTTCAATGTGTACTCTCACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005520.1-268s1c1
Sequence:CCGGGAAGTCAAATTGGCCCTGAAACTCGAGTTTCAGGGCCAATTTGACTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_005520.1-650s1c1
Sequence:CCGGCTCATTATGATCCACCACGAACTCGAGTTCGTGGTGGATCATAATGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236086    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_005520.2-1895s21c1
Sequence:CCGGTTGCCCTTTGCCACGTTAAATCTCGAGATTTAACGTGGCAAAGGGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_005520.2-375s21c1
Sequence:CCGGCAAGTCAAACAACGTTGAAATCTCGAGATTTCAACGTTGTTTGACTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005520.2-847s21c1
Sequence:CCGGGATGATTACAATGGCTATAATCTCGAGATTATAGCCATTGTAATCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_005520.2-681s21c1
Sequence:CCGGAGCTGAAGTTAGAACTCATTACTCGAGTAATGAGTTCTAACTTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_005520.2-703s21c1
Sequence:CCGGGATCCACCACGAAAGCTTATGCTCGAGCATAAGCTTTCGTGGTGGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005520
VALIDATED
HNRNPH1 MISSION shRNA Lentiviral Transduction Particles
heterogeneous nuclear ribonucleoprotein H1 (H)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000074593    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005520.1-1885s1c1
Sequence:CCGGGCATGTTGAAAGACATGCTTTCTCGAGAAAGCATGTCTTTCAACATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005520.1-911s1c1
Sequence:CCGGGCTCTACTTTCCAGAGCACAACTCGAGTTGTGCTCTGGAAAGTAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_005520.1-1012s1c1
Sequence:CCGGCCTGTGAGAGTACACATTGAACTCGAGTTCAATGTGTACTCTCACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005520.1-268s1c1
Sequence:CCGGGAAGTCAAATTGGCCCTGAAACTCGAGTTTCAGGGCCAATTTGACTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_005520.1-650s1c1
Sequence:CCGGCTCATTATGATCCACCACGAACTCGAGTTCGTGGTGGATCATAATGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236086    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_005520.2-1895s21c1
Sequence:CCGGTTGCCCTTTGCCACGTTAAATCTCGAGATTTAACGTGGCAAAGGGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_005520.2-375s21c1
Sequence:CCGGCAAGTCAAACAACGTTGAAATCTCGAGATTTCAACGTTGTTTGACTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005520.2-847s21c1
Sequence:CCGGGATGATTACAATGGCTATAATCTCGAGATTATAGCCATTGTAATCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_005520.2-681s21c1
Sequence:CCGGAGCTGAAGTTAGAACTCATTACTCGAGTAATGAGTTCTAACTTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_005520.2-703s21c1
Sequence:CCGGGATCCACCACGAAAGCTTATGCTCGAGCATAAGCTTTCGTGGTGGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)