EMAIL THIS PAGE TO A FRIEND

HNRNPH3

heterogeneous nuclear ribonucleoprotein H3 (2H9)

134 Gene Product Result for
Synonyms: 2H9 HNRPH3
Gene ID:
Human(3189) Summary: This gene belongs to the subfamily of ubiquitously expressed heterogeneous nuclear ribonucleoproteins (hnRNPs). The hnRNPs are RNA binding proteins and they complex with heterogeneous nuclear RNA (hnRNA). These proteins are associated with pre-mRNAs in the nucleus and appear to influence pre-mRNA processing and other aspects of mRNA metabolism and transport. While all of the hnRNPs are present in the nucleus, some seem to shuttle between the nucleus and the cytoplasm. The hnRNP proteins have distinct nucleic acid binding properties. The protein encoded by this gene has two repeats of quasi-RRM domains that bind to RNAs. It is localized in nuclear bodies of the nucleus. This protein is involved in the splicing process and it also participates in early heat shock-induced splicing arrest by transiently leaving the hnRNP complexes. Several alternatively spliced transcript variants have been noted for this gene, however, not all are fully characterized. [provided by RefSeq, Jul 2008]
Mouse(432467) heterogeneous nuclear ribonucleoprotein H3
Rat(361838) heterogeneous nuclear ribonucleoprotein H3 (2H9)
domestic guinea pig(100717850) heterogeneous nuclear ribonucleoprotein H3 (2H9)
naked mole-rat(101697454) heterogeneous nuclear ribonucleoprotein H3 (2H9)
sheep(101104959) heterogeneous nuclear ribonucleoprotein H3 (2H9)
chicken(423686) heterogeneous nuclear ribonucleoprotein H3 (2H9)
domestic cat(101090550) heterogeneous nuclear ribonucleoprotein H3 (2H9)
cow(539850) heterogeneous nuclear ribonucleoprotein H3 (2H9)
Horse(100063127) heterogeneous nuclear ribonucleoprotein H3 (2H9)
dog(479227) heterogeneous nuclear ribonucleoprotein H3 (2H9)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1100183 Anti-HNRNPH3 (131-145) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
AV40721 Anti-HNRPH3 antibody produced in rabbit IgG fraction of antiserum canine, rat, human, guinea pig, rabbit, zebrafish, horse, mouse, bovine
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012207 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012207 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012207 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_483910 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_483910 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_483910 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001079824 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001079824 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001079824 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012207 Rosetta Predictions human pricing
NM_021644 Rosetta Predictions human pricing
NM_001108532 Rosetta Predictions rat pricing
NM_001079824 Rosetta Predictions mouse pricing
XM_897051 Rosetta Predictions mouse pricing
XM_897074 Rosetta Predictions mouse pricing
XM_897083 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012207 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00343865 predicted 272
2 SASI_Hs01_00067996 predicted 1139
3 SASI_Hs01_00067997 predicted 993
4 SASI_Hs02_00343866 predicted 239
5 SASI_Hs02_00343867 predicted 878
6 SASI_Hs01_00067999 predicted 1755
7 SASI_Hs01_00068001 predicted 1708
8 SASI_Hs02_00343868 predicted 294
9 SASI_Hs02_00343869 predicted 949
10 SASI_Hs01_00068002 predicted 354
11 SASI_Hs01_00067994 predicted 1066
12 SASI_Hs01_00067995 predicted 977
13 SASI_Hs01_00067998 predicted 958
14 SASI_Hs01_00068000 predicted 1627
15 SASI_Hs01_00068003 predicted 1059
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021644 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00355012 predicted 269
2 SASI_Hs01_00241148 predicted 1100
3 SASI_Hs01_00241149 predicted 951
4 SASI_Hs02_00355013 predicted 241
5 SASI_Hs02_00355014 predicted 831
6 SASI_Hs01_00241151 predicted 1714
7 SASI_Hs01_00241153 predicted 1658
8 SASI_Hs02_00355015 predicted 292
9 SASI_Hs02_00355016 predicted 907
10 SASI_Hs01_00241154 predicted 359
11 SASI_Hs01_00241146 predicted 1015
12 SASI_Hs01_00241147 predicted 924
13 SASI_Hs01_00241150 predicted 912
14 SASI_Hs01_00241152 predicted 1585
15 SASI_Hs01_00241155 predicted 1017
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108532 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00239569 predicted 499
2 SASI_Rn02_00239570 predicted 677
3 SASI_Rn02_00239571 predicted 679
4 SASI_Rn02_00239572 predicted 473
5 SASI_Rn02_00239573 predicted 582
6 SASI_Rn02_00239574 predicted 1094
7 SASI_Rn02_00239575 predicted 665
8 SASI_Rn02_00239576 predicted 472
9 SASI_Rn02_00239577 predicted 1102
10 SASI_Rn02_00239578 predicted 789
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079824 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00293072 predicted 631
2 SASI_Mm02_00293073 predicted 604
3 SASI_Mm02_00293074 predicted 716
4 SASI_Mm02_00293075 predicted 344
5 SASI_Mm02_00293076 predicted 604
6 SASI_Mm02_00293077 predicted 809
7 SASI_Mm02_00293078 predicted 631
8 SASI_Mm02_00293079 predicted 830
9 SASI_Mm02_00293080 predicted 877
10 SASI_Mm02_00293081 predicted 539
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_897051 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00281727 predicted 1169
2 SASI_Mm01_00281728 predicted 1181
3 SASI_Mm01_00281729 predicted 602
4 SASI_Mm01_00281730 predicted 1354
5 SASI_Mm01_00281731 predicted 699
6 SASI_Mm01_00281732 predicted 765
7 SASI_Mm01_00281733 predicted 1250
8 SASI_Mm01_00281734 predicted 1374
9 SASI_Mm01_00281735 predicted 817
10 SASI_Mm01_00281736 predicted 1236
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_897074 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00271818 predicted 520
2 SASI_Mm01_00271819 predicted 530
3 SASI_Mm01_00271820 predicted 881
4 SASI_Mm01_00271821 predicted 909
5 SASI_Mm01_00271822 predicted 891
6 SASI_Mm01_00271823 predicted 899
7 SASI_Mm01_00271824 predicted 694
8 SASI_Mm01_00271825 predicted 878
9 SASI_Mm01_00271826 predicted 590
10 SASI_Mm01_00271827 predicted 582
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_897083 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00229215 predicted 434
2 SASI_Mm01_00229216 predicted 1084
3 SASI_Mm01_00229217 predicted 414
4 SASI_Mm01_00229218 predicted 275
5 SASI_Mm01_00229219 predicted 528
6 SASI_Mm01_00229220 predicted 616
7 SASI_Mm01_00229221 predicted 435
8 SASI_Mm01_00229222 predicted 682
9 SASI_Mm01_00229223 predicted 340
10 SASI_Mm01_00229224 predicted 413
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012207
VALIDATED
HNRNPH3 MISSION shRNA Bacterial Glycerol Stock
heterogeneous nuclear ribonucleoprotein H3 (2H9)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000074618    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012207.1-1592s1c1
Sequence:CCGGCCTGGACAACACTGTAAATATCTCGAGATATTTACAGTGTTGTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_012207.1-393s1c1
Sequence:CCGGGCAGGAGTGAAATCAAAGGATCTCGAGATCCTTTGATTTCACTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012207.1-450s1c1
Sequence:CCGGCGGGACCATATGATAGACCAACTCGAGTTGGTCTATCATATGGTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_012207.1-1061s1c1
Sequence:CCGGCCTGATGGTTTGGGTGGTTATCTCGAGATAACCACCCAAACCATCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012207.1-504s1c1
Sequence:CCGGGTGGAAGTATGTATGACAGAACTCGAGTTCTGTCATACATACTTCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_012207.2-1172s21c1
Sequence:CCGGCCTGATGGTTTGGGTGGTTATCTCGAGATAACCACCCAAACCATCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012207.2-504s21c1
Sequence:CCGGGCAGGAGTGAAATCAAAGGATCTCGAGATCCTTTGATTTCACTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293658    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012207.2-1531s21c1
Sequence:CCGGTGTGCTGCCTTCATAAGATTTCTCGAGAAATCTTATGAAGGCAGCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_012207.2-285s21c1
Sequence:CCGGGACTTCGTGGACTACCATTTGCTCGAGCAAATGGTAGTCCACGAAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_012207.2-997s21c1
Sequence:CCGGTAACATGCAACATCGATATATCTCGAGATATATCGATGTTGCATGTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012207
VALIDATED
HNRNPH3 MISSION shRNA shRNA Plasmid DNA
heterogeneous nuclear ribonucleoprotein H3 (2H9)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000074618    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012207.1-1592s1c1
Sequence:CCGGCCTGGACAACACTGTAAATATCTCGAGATATTTACAGTGTTGTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_012207.1-393s1c1
Sequence:CCGGGCAGGAGTGAAATCAAAGGATCTCGAGATCCTTTGATTTCACTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012207.1-450s1c1
Sequence:CCGGCGGGACCATATGATAGACCAACTCGAGTTGGTCTATCATATGGTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_012207.1-1061s1c1
Sequence:CCGGCCTGATGGTTTGGGTGGTTATCTCGAGATAACCACCCAAACCATCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012207.1-504s1c1
Sequence:CCGGGTGGAAGTATGTATGACAGAACTCGAGTTCTGTCATACATACTTCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_012207.2-1172s21c1
Sequence:CCGGCCTGATGGTTTGGGTGGTTATCTCGAGATAACCACCCAAACCATCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012207.2-504s21c1
Sequence:CCGGGCAGGAGTGAAATCAAAGGATCTCGAGATCCTTTGATTTCACTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293658    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012207.2-1531s21c1
Sequence:CCGGTGTGCTGCCTTCATAAGATTTCTCGAGAAATCTTATGAAGGCAGCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_012207.2-285s21c1
Sequence:CCGGGACTTCGTGGACTACCATTTGCTCGAGCAAATGGTAGTCCACGAAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_012207.2-997s21c1
Sequence:CCGGTAACATGCAACATCGATATATCTCGAGATATATCGATGTTGCATGTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012207
VALIDATED
HNRNPH3 MISSION shRNA Lentiviral Transduction Particles
heterogeneous nuclear ribonucleoprotein H3 (2H9)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000074618    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012207.1-1592s1c1
Sequence:CCGGCCTGGACAACACTGTAAATATCTCGAGATATTTACAGTGTTGTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_012207.1-393s1c1
Sequence:CCGGGCAGGAGTGAAATCAAAGGATCTCGAGATCCTTTGATTTCACTCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012207.1-450s1c1
Sequence:CCGGCGGGACCATATGATAGACCAACTCGAGTTGGTCTATCATATGGTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_012207.1-1061s1c1
Sequence:CCGGCCTGATGGTTTGGGTGGTTATCTCGAGATAACCACCCAAACCATCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012207.1-504s1c1
Sequence:CCGGGTGGAAGTATGTATGACAGAACTCGAGTTCTGTCATACATACTTCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_012207.2-1172s21c1
Sequence:CCGGCCTGATGGTTTGGGTGGTTATCTCGAGATAACCACCCAAACCATCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012207.2-504s21c1
Sequence:CCGGGCAGGAGTGAAATCAAAGGATCTCGAGATCCTTTGATTTCACTCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293658    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012207.2-1531s21c1
Sequence:CCGGTGTGCTGCCTTCATAAGATTTCTCGAGAAATCTTATGAAGGCAGCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_012207.2-285s21c1
Sequence:CCGGGACTTCGTGGACTACCATTTGCTCGAGCAAATGGTAGTCCACGAAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_012207.2-997s21c1
Sequence:CCGGTAACATGCAACATCGATATATCTCGAGATATATCGATGTTGCATGTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_483910
HNRNPH3 MISSION shRNA Bacterial Glycerol Stock
heterogeneous nuclear ribonucleoprotein H3 (2H9)
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000204132    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_483910.1-1175s1c1
Sequence:CCGGGCAGGAGTGAAATCAAAGGATCTCGAGATCCTTTGATTTCACTCCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186381    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_483910.1-2165s1c1
Sequence:CCGGCCCTGGACATACTGTAAATAACTCGAGTTATTTACAGTATGTCCAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186655    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_483910.1-2349s1c1
Sequence:CCGGGCACTTGACTAAGATACCAAACTCGAGTTTGGTATCTTAGTCAAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_483910.1-1093s1c1
Sequence:CCGGGCTTCAAAGGAGATAGCAGAACTCGAGTTCTGCTATCTCCTTTGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_483910.1-1232s1c1
Sequence:CCGGCGGGACCATATGATAGACCAACTCGAGTTGGTCTATCATATGGTCCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203108    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_483910.1-898s1c1
Sequence:CCGGGAAATGGATTGGGTTATGAAACTCGAGTTTCATAACCCAATCCATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_483910
HNRNPH3 MISSION shRNA shRNA Plasmid DNA
heterogeneous nuclear ribonucleoprotein H3 (2H9)
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000204132    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_483910.1-1175s1c1
Sequence:CCGGGCAGGAGTGAAATCAAAGGATCTCGAGATCCTTTGATTTCACTCCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000186381    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_483910.1-2165s1c1
Sequence:CCGGCCCTGGACATACTGTAAATAACTCGAGTTATTTACAGTATGTCCAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000186655    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_483910.1-2349s1c1
Sequence:CCGGGCACTTGACTAAGATACCAAACTCGAGTTTGGTATCTTAGTCAAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000187666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_483910.1-1093s1c1
Sequence:CCGGGCTTCAAAGGAGATAGCAGAACTCGAGTTCTGCTATCTCCTTTGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000188227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_483910.1-1232s1c1
Sequence:CCGGCGGGACCATATGATAGACCAACTCGAGTTGGTCTATCATATGGTCCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000203108    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_483910.1-898s1c1
Sequence:CCGGGAAATGGATTGGGTTATGAAACTCGAGTTTCATAACCCAATCCATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_483910
HNRNPH3 MISSION shRNA Lentiviral Transduction Particles
heterogeneous nuclear ribonucleoprotein H3 (2H9)
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000204132    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_483910.1-1175s1c1
Sequence:CCGGGCAGGAGTGAAATCAAAGGATCTCGAGATCCTTTGATTTCACTCCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186381    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_483910.1-2165s1c1
Sequence:CCGGCCCTGGACATACTGTAAATAACTCGAGTTATTTACAGTATGTCCAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186655    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_483910.1-2349s1c1
Sequence:CCGGGCACTTGACTAAGATACCAAACTCGAGTTTGGTATCTTAGTCAAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_483910.1-1093s1c1
Sequence:CCGGGCTTCAAAGGAGATAGCAGAACTCGAGTTCTGCTATCTCCTTTGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_483910.1-1232s1c1
Sequence:CCGGCGGGACCATATGATAGACCAACTCGAGTTGGTCTATCATATGGTCCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203108    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_483910.1-898s1c1
Sequence:CCGGGAAATGGATTGGGTTATGAAACTCGAGTTTCATAACCCAATCCATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001079824
VALIDATED
HNRNPH3 MISSION shRNA Bacterial Glycerol Stock
heterogeneous nuclear ribonucleoprotein H3 (2H9)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000347158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001079824.1-1009s21c1
Sequence:CCGGGGCAGAGATGGAATGGATAATCTCGAGATTATCCATTCCATCTCTGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216230    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001079824.1-921s1c1
Sequence:CCGGCAACATGCAACATCGATACATCTCGAGATGTATCGATGTTGCATGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001079824.1-789s21c1
Sequence:CCGGTAATTTCTTCTCACCGCTCAACTCGAGTTGAGCGGTGAGAAGAAATTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001079824.1-209s21c1
Sequence:CCGGGACTTCGTGGACTGCCATTTGCTCGAGCAAATGGCAGTCCACGAAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079824.1-577s21c1
Sequence:CCGGGGATATGATGGTGGCTATGGACTCGAGTCCATAGCCACCATCATATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001079824
VALIDATED
HNRNPH3 MISSION shRNA shRNA Plasmid DNA
heterogeneous nuclear ribonucleoprotein H3 (2H9)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000347158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001079824.1-1009s21c1
Sequence:CCGGGGCAGAGATGGAATGGATAATCTCGAGATTATCCATTCCATCTCTGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216230    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001079824.1-921s1c1
Sequence:CCGGCAACATGCAACATCGATACATCTCGAGATGTATCGATGTTGCATGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000347076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001079824.1-789s21c1
Sequence:CCGGTAATTTCTTCTCACCGCTCAACTCGAGTTGAGCGGTGAGAAGAAATTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000347162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001079824.1-209s21c1
Sequence:CCGGGACTTCGTGGACTGCCATTTGCTCGAGCAAATGGCAGTCCACGAAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000347077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079824.1-577s21c1
Sequence:CCGGGGATATGATGGTGGCTATGGACTCGAGTCCATAGCCACCATCATATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001079824
VALIDATED
HNRNPH3 MISSION shRNA Lentiviral Transduction Particles
heterogeneous nuclear ribonucleoprotein H3 (2H9)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000347158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001079824.1-1009s21c1
Sequence:CCGGGGCAGAGATGGAATGGATAATCTCGAGATTATCCATTCCATCTCTGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216230    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001079824.1-921s1c1
Sequence:CCGGCAACATGCAACATCGATACATCTCGAGATGTATCGATGTTGCATGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001079824.1-789s21c1
Sequence:CCGGTAATTTCTTCTCACCGCTCAACTCGAGTTGAGCGGTGAGAAGAAATTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001079824.1-209s21c1
Sequence:CCGGGACTTCGTGGACTGCCATTTGCTCGAGCAAATGGCAGTCCACGAAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079824.1-577s21c1
Sequence:CCGGGGATATGATGGTGGCTATGGACTCGAGTCCATAGCCACCATCATATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)