EMAIL THIS PAGE TO A FRIEND

HNRNPL

heterogeneous nuclear ribonucleoprotein L

93 Gene Product Result for
Synonyms: HNRPL hnRNP-L
UniProtKB ID: P14866, A6ND69, A6NIT8, Q9H3P3
Gene ID:
Human(3191) Summary: Heterogeneous nuclear RNAs (hnRNAs) which include mRNA precursors and mature mRNAs are associated with specific proteins to form heterogenous ribonucleoprotein (hnRNP) complexes. Heterogeneous nuclear ribonucleoprotein L is among the proteins that are stably associated with hnRNP complexes and along with other hnRNP proteins is likely to play a major role in the formation, packaging, processing, and function of mRNA. Heterogeneous nuclear ribonucleoprotein L is present in the nucleoplasm as part of the HNRP complex. HNRP proteins have also been identified outside of the nucleoplasm. Exchange of hnRNP for mRNA-binding proteins accompanies transport of mRNA from the nucleus to the cytoplasm. Since HNRP proteins have been shown to shuttle between the nucleus and the cytoplasm, it is possible that they also have cytoplasmic functions. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(15388) heterogeneous nuclear ribonucleoprotein L
Rat(80846) heterogeneous nuclear ribonucleoprotein L
cow(504520) heterogeneous nuclear ribonucleoprotein L
Horse(100066483) heterogeneous nuclear ribonucleoprotein L
domestic cat(101099920) heterogeneous nuclear ribonucleoprotein L
dog(476466) heterogeneous nuclear ribonucleoprotein L
domestic guinea pig(100734238) heterogeneous nuclear ribonucleoprotein L
naked mole-rat(101713537) heterogeneous nuclear ribonucleoprotein L
sheep(101113093) heterogeneous nuclear ribonucleoprotein L
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001533 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001533 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001533 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177301 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177301 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177301 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005335 Rosetta Predictions human pricing
NM_001533 Rosetta Predictions human pricing
NM_001134760 Rosetta Predictions rat pricing
NM_032619 Rosetta Predictions rat pricing
NM_177301 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005335 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00080877 predicted 346
2 SASI_Hs01_00080878 predicted 1330
3 SASI_Hs01_00080879 predicted 1149
4 SASI_Hs01_00080880 predicted 459
5 SASI_Hs01_00080881 predicted 256
6 SASI_Hs01_00080882 predicted 530
7 SASI_Hs01_00080883 predicted 422
8 SASI_Hs01_00080884 predicted 484
9 SASI_Hs01_00080885 predicted 1180
10 SASI_Hs01_00080886 predicted 1199
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001533 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00211076 predicted 583
2 SASI_Hs01_00211077 predicted 1571
3 SASI_Hs01_00211078 predicted 1382
4 SASI_Hs01_00211079 predicted 701
5 SASI_Hs01_00211080 predicted 496
6 SASI_Hs01_00211081 predicted 767
7 SASI_Hs01_00211082 predicted 655
8 SASI_Hs01_00211083 predicted 709
9 SASI_Hs01_00211084 predicted 1410
10 SASI_Hs01_00211085 predicted 1434
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134760 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00258414 predicted 1501
2 SASI_Rn02_00258415 predicted 1663
3 SASI_Rn02_00258416 predicted 1504
4 SASI_Rn02_00258417 predicted 1639
5 SASI_Rn02_00258418 predicted 647
6 SASI_Rn02_00258419 predicted 1672
7 SASI_Rn02_00258420 predicted 1463
8 SASI_Rn02_00258421 predicted 612
9 SASI_Rn02_00258422 predicted 693
10 SASI_Rn02_00258423 predicted 1510
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032619 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00265486 predicted 1397
2 SASI_Rn02_00265487 predicted 1545
3 SASI_Rn02_00265488 predicted 1394
4 SASI_Rn02_00265489 predicted 1524
5 SASI_Rn02_00265490 predicted 640
6 SASI_Rn02_00265491 predicted 1556
7 SASI_Rn02_00265492 predicted 1356
8 SASI_Rn02_00265493 predicted 617
9 SASI_Rn02_00265494 predicted 700
10 SASI_Rn02_00265495 predicted 1408
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177301 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00072187 predicted 1569
2 SASI_Mm01_00072188 predicted 1503
3 SASI_Mm01_00072190 predicted 657
4 SASI_Mm01_00072191 predicted 492
5 SASI_Mm01_00072192 predicted 571
6 SASI_Mm01_00072193 predicted 1477
7 SASI_Mm01_00072194 predicted 625
8 SASI_Mm01_00072195 predicted 770
9 SASI_Mm01_00072196 predicted 663
10 SASI_Mm02_00347375 predicted 1582
11 SASI_Mm01_00072189 predicted 696
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001533
VALIDATED
HNRNPL MISSION shRNA Bacterial Glycerol Stock
heterogeneous nuclear ribonucleoprotein L
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000330619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001533.2-483s21c1
Sequence:CCGGGCCGACAACCAAATATACATTCTCGAGAATGTATATTTGGTTGTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_001533.2-825s21c1
Sequence:CCGGCGCTTGAATGTGTTCAAGAATCTCGAGATTCTTGAACACATTCAAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330565    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_001533.2-1919s21c1
Sequence:CCGGTAGAGGCTTACTTAACCTTAACTCGAGTTAAGGTTAAGTAAGCCTCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_001533.2-1325s21c1
Sequence:CCGGCCTCAACAACAACTTCATGTTCTCGAGAACATGAAGTTGTTGTTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001533.1-555s1c1
Sequence:CCGGCCACGGATGTTCTTTACACTACTCGAGTAGTGTAAAGAACATCCGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001533.1-315s1c1
Sequence:CCGGCCATCAGCTATGTGGTGGTAACTCGAGTTACCACCACATAGCTGATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001533.1-749s1c1
Sequence:CCGGCGCTTGAATGTGTTCAAGAATCTCGAGATTCTTGAACACATTCAAGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001533.1-1249s1c1
Sequence:CCGGCCTCAACAACAACTTCATGTTCTCGAGAACATGAAGTTGTTGTTGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001533.1-407s1c1
Sequence:CCGGGCCGACAACCAAATATACATTCTCGAGAATGTATATTTGGTTGTCGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001533
VALIDATED
HNRNPL MISSION shRNA shRNA Plasmid DNA
heterogeneous nuclear ribonucleoprotein L
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000330619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001533.2-483s21c1
Sequence:CCGGGCCGACAACCAAATATACATTCTCGAGAATGTATATTTGGTTGTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_001533.2-825s21c1
Sequence:CCGGCGCTTGAATGTGTTCAAGAATCTCGAGATTCTTGAACACATTCAAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330565    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_001533.2-1919s21c1
Sequence:CCGGTAGAGGCTTACTTAACCTTAACTCGAGTTAAGGTTAAGTAAGCCTCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_001533.2-1325s21c1
Sequence:CCGGCCTCAACAACAACTTCATGTTCTCGAGAACATGAAGTTGTTGTTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001533.1-555s1c1
Sequence:CCGGCCACGGATGTTCTTTACACTACTCGAGTAGTGTAAAGAACATCCGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001533.1-315s1c1
Sequence:CCGGCCATCAGCTATGTGGTGGTAACTCGAGTTACCACCACATAGCTGATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001533.1-749s1c1
Sequence:CCGGCGCTTGAATGTGTTCAAGAATCTCGAGATTCTTGAACACATTCAAGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001533.1-1249s1c1
Sequence:CCGGCCTCAACAACAACTTCATGTTCTCGAGAACATGAAGTTGTTGTTGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001533.1-407s1c1
Sequence:CCGGGCCGACAACCAAATATACATTCTCGAGAATGTATATTTGGTTGTCGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001533
VALIDATED
HNRNPL MISSION shRNA Lentiviral Transduction Particles
heterogeneous nuclear ribonucleoprotein L
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000330619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001533.2-483s21c1
Sequence:CCGGGCCGACAACCAAATATACATTCTCGAGAATGTATATTTGGTTGTCGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_001533.2-825s21c1
Sequence:CCGGCGCTTGAATGTGTTCAAGAATCTCGAGATTCTTGAACACATTCAAGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330565    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_001533.2-1919s21c1
Sequence:CCGGTAGAGGCTTACTTAACCTTAACTCGAGTTAAGGTTAAGTAAGCCTCTATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_001533.2-1325s21c1
Sequence:CCGGCCTCAACAACAACTTCATGTTCTCGAGAACATGAAGTTGTTGTTGAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001533.1-555s1c1
Sequence:CCGGCCACGGATGTTCTTTACACTACTCGAGTAGTGTAAAGAACATCCGTGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001533.1-315s1c1
Sequence:CCGGCCATCAGCTATGTGGTGGTAACTCGAGTTACCACCACATAGCTGATGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001533.1-749s1c1
Sequence:CCGGCGCTTGAATGTGTTCAAGAATCTCGAGATTCTTGAACACATTCAAGCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001533.1-1249s1c1
Sequence:CCGGCCTCAACAACAACTTCATGTTCTCGAGAACATGAAGTTGTTGTTGAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001533.1-407s1c1
Sequence:CCGGGCCGACAACCAAATATACATTCTCGAGAATGTATATTTGGTTGTCGGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177301
VALIDATED
HNRNPL MISSION shRNA Bacterial Glycerol Stock
heterogeneous nuclear ribonucleoprotein L
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000295128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177301.5-513s21c1
Sequence:CCGGCCCTGCATTTGTCAATTATTCCTCGAGGAATAATTGACAAATGCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177301.5-812s21c1
Sequence:CCGGACGCAAAGCCTACGCGTTTAACTCGAGTTAAACGCGTAGGCTTTGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177301.5-670s21c1
Sequence:CCGGCCTGTCCAGAGAATTGTCATTCTCGAGAATGACAATTCTCTGGACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177301.5-1695s21c1
Sequence:CCGGCCTGAACCATTACCAGATGAACTCGAGTTCATCTGGTAATGGTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112035    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177301.3-1981s1c1
Sequence:CCGGCCCAAGATTAACCTTCACTTTCTCGAGAAAGTGAAGGTTAATCTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177301.3-352s1c1
Sequence:CCGGCCTGCAAGAATTTGGACCCATCTCGAGATGGGTCCAAATTCTTGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177301.3-647s1c1
Sequence:CCGGCCTGTCCAGAGAATTGTCATTCTCGAGAATGACAATTCTCTGGACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177301.3-571s1c1
Sequence:CCGGGCTTCTGTTTACCATCCTAAACTCGAGTTTAGGATGGTAAACAGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177301.3-1672s1c1
Sequence:CCGGCCTGAACCATTACCAGATGAACTCGAGTTCATCTGGTAATGGTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287716    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177301.5-2005s21c1
Sequence:CCGGCCCAAGATTAACCTTCACTTTCTCGAGAAAGTGAAGGTTAATCTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177301
VALIDATED
HNRNPL MISSION shRNA shRNA Plasmid DNA
heterogeneous nuclear ribonucleoprotein L
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000295128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177301.5-513s21c1
Sequence:CCGGCCCTGCATTTGTCAATTATTCCTCGAGGAATAATTGACAAATGCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177301.5-812s21c1
Sequence:CCGGACGCAAAGCCTACGCGTTTAACTCGAGTTAAACGCGTAGGCTTTGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177301.5-670s21c1
Sequence:CCGGCCTGTCCAGAGAATTGTCATTCTCGAGAATGACAATTCTCTGGACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177301.5-1695s21c1
Sequence:CCGGCCTGAACCATTACCAGATGAACTCGAGTTCATCTGGTAATGGTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112035    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177301.3-1981s1c1
Sequence:CCGGCCCAAGATTAACCTTCACTTTCTCGAGAAAGTGAAGGTTAATCTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177301.3-352s1c1
Sequence:CCGGCCTGCAAGAATTTGGACCCATCTCGAGATGGGTCCAAATTCTTGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177301.3-647s1c1
Sequence:CCGGCCTGTCCAGAGAATTGTCATTCTCGAGAATGACAATTCTCTGGACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177301.3-571s1c1
Sequence:CCGGGCTTCTGTTTACCATCCTAAACTCGAGTTTAGGATGGTAAACAGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177301.3-1672s1c1
Sequence:CCGGCCTGAACCATTACCAGATGAACTCGAGTTCATCTGGTAATGGTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287716    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177301.5-2005s21c1
Sequence:CCGGCCCAAGATTAACCTTCACTTTCTCGAGAAAGTGAAGGTTAATCTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177301
VALIDATED
HNRNPL MISSION shRNA Lentiviral Transduction Particles
heterogeneous nuclear ribonucleoprotein L
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000295128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177301.5-513s21c1
Sequence:CCGGCCCTGCATTTGTCAATTATTCCTCGAGGAATAATTGACAAATGCAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177301.5-812s21c1
Sequence:CCGGACGCAAAGCCTACGCGTTTAACTCGAGTTAAACGCGTAGGCTTTGCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177301.5-670s21c1
Sequence:CCGGCCTGTCCAGAGAATTGTCATTCTCGAGAATGACAATTCTCTGGACAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177301.5-1695s21c1
Sequence:CCGGCCTGAACCATTACCAGATGAACTCGAGTTCATCTGGTAATGGTTCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112035    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177301.3-1981s1c1
Sequence:CCGGCCCAAGATTAACCTTCACTTTCTCGAGAAAGTGAAGGTTAATCTTGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177301.3-352s1c1
Sequence:CCGGCCTGCAAGAATTTGGACCCATCTCGAGATGGGTCCAAATTCTTGCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177301.3-647s1c1
Sequence:CCGGCCTGTCCAGAGAATTGTCATTCTCGAGAATGACAATTCTCTGGACAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177301.3-571s1c1
Sequence:CCGGGCTTCTGTTTACCATCCTAAACTCGAGTTTAGGATGGTAAACAGAAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177301.3-1672s1c1
Sequence:CCGGCCTGAACCATTACCAGATGAACTCGAGTTCATCTGGTAATGGTTCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287716    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177301.5-2005s21c1
Sequence:CCGGCCCAAGATTAACCTTCACTTTCTCGAGAAAGTGAAGGTTAATCTTGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)