EMAIL THIS PAGE TO A FRIEND

HNRNPLL

heterogeneous nuclear ribonucleoprotein L-like

64 Gene Product Result for
Synonyms: HNRPLL SRRF
Gene ID:
Human(92906) Summary: HNRNPLL is a master regulator of activation-induced alternative splicing in T cells. In particular, it alters splicing of CD45 (PTPRC; MIM 151460), a tyrosine phosphatase essential for T-cell development and activation (Oberdoerffer et al., 2008 [PubMed 18669861]
Mouse(72692) heterogeneous nuclear ribonucleoprotein L-like
Rat(313842) heterogeneous nuclear ribonucleoprotein L-like
domestic guinea pig(100713480) heterogeneous nuclear ribonucleoprotein L-like
naked mole-rat(101702256) heterogeneous nuclear ribonucleoprotein L-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144802 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144802 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144802 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_138394 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138394 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138394 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138394 Rosetta Predictions human pricing
XM_001063027 Rosetta Predictions rat pricing
XM_233805 Rosetta Predictions rat pricing
NM_144802 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138394 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00171039 predicted 1266
2 SASI_Hs01_00171040 predicted 928
3 SASI_Hs01_00171041 predicted 1122
4 SASI_Hs01_00171042 predicted 1454
5 SASI_Hs01_00171043 predicted 787
6 SASI_Hs02_00363538 predicted 1098
7 SASI_Hs01_00171044 predicted 659
8 SASI_Hs02_00363539 predicted 857
9 SASI_Hs01_00171045 predicted 1389
10 SASI_Hs01_00171046 predicted 835
11 SASI_Hs01_00171047 predicted 884
12 SASI_Hs01_00171048 predicted 639
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063027 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00305489 predicted 1435
2 SASI_Rn02_00305490 predicted 272
3 SASI_Rn02_00305491 predicted 1323
4 SASI_Rn02_00305492 predicted 2440
5 SASI_Rn02_00305493 predicted 1598
6 SASI_Rn02_00305494 predicted 1766
7 SASI_Rn02_00305495 predicted 1258
8 SASI_Rn02_00305496 predicted 1634
9 SASI_Rn02_00305497 predicted 1197
10 SASI_Rn02_00305498 predicted 1370
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_233805 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00388060 predicted 1435
2 SASI_Rn02_00388061 predicted 277
3 SASI_Rn02_00388062 predicted 1325
4 SASI_Rn02_00388063 predicted 2438
5 SASI_Rn02_00388064 predicted 1598
6 SASI_Rn02_00388065 predicted 1763
7 SASI_Rn02_00388066 predicted 1258
8 SASI_Rn02_00388067 predicted 1625
9 SASI_Rn02_00388068 predicted 1193
10 SASI_Rn02_00388069 predicted 1376
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144802 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00098908 predicted 1551
2 SASI_Mm01_00098909 predicted 1156
3 SASI_Mm01_00098911 predicted 1042
4 SASI_Mm01_00098912 predicted 1719
5 SASI_Mm01_00098914 predicted 914
6 SASI_Mm02_00340151 predicted 804
7 SASI_Mm01_00098915 predicted 1019
8 SASI_Mm01_00098916 predicted 2194
9 SASI_Mm02_00340152 predicted 1028
10 SASI_Mm01_00098917 predicted 2033
11 SASI_Mm01_00098910 predicted 1780
12 SASI_Mm01_00098913 predicted 1311
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144802
VALIDATED
HNRNPLL MISSION shRNA Bacterial Glycerol Stock
heterogeneous nuclear ribonucleoprotein L-like
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000123504    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144802.2-2136s1c1
Sequence:CCGGGCCTCAAGTAAGTTTGTTGTTCTCGAGAACAACAAACTTACTTGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144802.2-1724s1c1
Sequence:CCGGCGTCATGTGTGCTGCATTATTCTCGAGAATAATGCAGCACACATGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144802.2-1912s1c1
Sequence:CCGGGCGCTCAATCACTACCAGATACTCGAGTATCTGGTAGTGATTGAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144802.2-1723s1c1
Sequence:CCGGCCGTCATGTGTGCTGCATTATCTCGAGATAATGCAGCACACATGACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144802.2-739s1c1
Sequence:CCGGGCCAAAGAATGTGTGACATTTCTCGAGAAATGTCACACATTCTTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294975    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144802.3-2512s21c1
Sequence:CCGGCTGTTACAGTTACTCATATTACTCGAGTAATATGAGTAACTGTAACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144802.3-1261s21c1
Sequence:CCGGGACTACACTAAACCTTATTTGCTCGAGCAAATAAGGTTTAGTGTAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144802.3-1011s21c1
Sequence:CCGGGAATCCTCTTTACCCAATTACCTCGAGGTAATTGGGTAAAGAGGATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144802.3-1160s21c1
Sequence:CCGGCACTCAATGGAGCTGATATATCTCGAGATATATCAGCTCCATTGAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144802.3-1844s21c1
Sequence:CCGGCGTCATGTGTGCTGCATTATTCTCGAGAATAATGCAGCACACATGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144802
VALIDATED
HNRNPLL MISSION shRNA shRNA Plasmid DNA
heterogeneous nuclear ribonucleoprotein L-like
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000123504    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144802.2-2136s1c1
Sequence:CCGGGCCTCAAGTAAGTTTGTTGTTCTCGAGAACAACAAACTTACTTGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144802.2-1724s1c1
Sequence:CCGGCGTCATGTGTGCTGCATTATTCTCGAGAATAATGCAGCACACATGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144802.2-1912s1c1
Sequence:CCGGGCGCTCAATCACTACCAGATACTCGAGTATCTGGTAGTGATTGAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144802.2-1723s1c1
Sequence:CCGGCCGTCATGTGTGCTGCATTATCTCGAGATAATGCAGCACACATGACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144802.2-739s1c1
Sequence:CCGGGCCAAAGAATGTGTGACATTTCTCGAGAAATGTCACACATTCTTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294975    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144802.3-2512s21c1
Sequence:CCGGCTGTTACAGTTACTCATATTACTCGAGTAATATGAGTAACTGTAACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144802.3-1261s21c1
Sequence:CCGGGACTACACTAAACCTTATTTGCTCGAGCAAATAAGGTTTAGTGTAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144802.3-1011s21c1
Sequence:CCGGGAATCCTCTTTACCCAATTACCTCGAGGTAATTGGGTAAAGAGGATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144802.3-1160s21c1
Sequence:CCGGCACTCAATGGAGCTGATATATCTCGAGATATATCAGCTCCATTGAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144802.3-1844s21c1
Sequence:CCGGCGTCATGTGTGCTGCATTATTCTCGAGAATAATGCAGCACACATGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144802
VALIDATED
HNRNPLL MISSION shRNA Lentiviral Transduction Particles
heterogeneous nuclear ribonucleoprotein L-like
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000123504    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144802.2-2136s1c1
Sequence:CCGGGCCTCAAGTAAGTTTGTTGTTCTCGAGAACAACAAACTTACTTGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144802.2-1724s1c1
Sequence:CCGGCGTCATGTGTGCTGCATTATTCTCGAGAATAATGCAGCACACATGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144802.2-1912s1c1
Sequence:CCGGGCGCTCAATCACTACCAGATACTCGAGTATCTGGTAGTGATTGAGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144802.2-1723s1c1
Sequence:CCGGCCGTCATGTGTGCTGCATTATCTCGAGATAATGCAGCACACATGACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144802.2-739s1c1
Sequence:CCGGGCCAAAGAATGTGTGACATTTCTCGAGAAATGTCACACATTCTTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294975    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144802.3-2512s21c1
Sequence:CCGGCTGTTACAGTTACTCATATTACTCGAGTAATATGAGTAACTGTAACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144802.3-1261s21c1
Sequence:CCGGGACTACACTAAACCTTATTTGCTCGAGCAAATAAGGTTTAGTGTAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144802.3-1011s21c1
Sequence:CCGGGAATCCTCTTTACCCAATTACCTCGAGGTAATTGGGTAAAGAGGATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144802.3-1160s21c1
Sequence:CCGGCACTCAATGGAGCTGATATATCTCGAGATATATCAGCTCCATTGAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144802.3-1844s21c1
Sequence:CCGGCGTCATGTGTGCTGCATTATTCTCGAGAATAATGCAGCACACATGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138394
VALIDATED
HNRNPLL MISSION shRNA Bacterial Glycerol Stock
heterogeneous nuclear ribonucleoprotein L-like
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000075101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_138394.2-590s1c1
Sequence:CCGGCGACAGGCTCTAGTGGAATTTCTCGAGAAATTCCACTAGAGCCTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075098    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_138394.2-1889s1c1
Sequence:CCGGGAGAAGAGCATGTTAGAATTTCTCGAGAAATTCTAACATGCTCTTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_138394.2-1103s1c1
Sequence:CCGGCCTTCTTCGTTTAGACATGATCTCGAGATCATGTCTAAACGAAGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_138394.2-834s1c1
Sequence:CCGGGCAAAGTGCAACGTATTGTTACTCGAGTAACAATACGTTGCACTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_138394.2-1799s1c1
Sequence:CCGGGCACTGAATCACTATCAGATACTCGAGTATCTGATAGTGATTCAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138394.3-932s21c1
Sequence:CCGGGAATCCGCTTTATCCAATTACCTCGAGGTAATTGGATAAAGCGGATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428101    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138394.3-2347s21c1
Sequence:CCGGGCTAATTATCTGCAAGTATTTCTCGAGAAATACTTGCAGATAATTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138394
VALIDATED
HNRNPLL MISSION shRNA shRNA Plasmid DNA
heterogeneous nuclear ribonucleoprotein L-like
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000075101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_138394.2-590s1c1
Sequence:CCGGCGACAGGCTCTAGTGGAATTTCTCGAGAAATTCCACTAGAGCCTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075098    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_138394.2-1889s1c1
Sequence:CCGGGAGAAGAGCATGTTAGAATTTCTCGAGAAATTCTAACATGCTCTTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_138394.2-1103s1c1
Sequence:CCGGCCTTCTTCGTTTAGACATGATCTCGAGATCATGTCTAAACGAAGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_138394.2-834s1c1
Sequence:CCGGGCAAAGTGCAACGTATTGTTACTCGAGTAACAATACGTTGCACTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_138394.2-1799s1c1
Sequence:CCGGGCACTGAATCACTATCAGATACTCGAGTATCTGATAGTGATTCAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138394.3-932s21c1
Sequence:CCGGGAATCCGCTTTATCCAATTACCTCGAGGTAATTGGATAAAGCGGATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428101    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138394.3-2347s21c1
Sequence:CCGGGCTAATTATCTGCAAGTATTTCTCGAGAAATACTTGCAGATAATTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138394
VALIDATED
HNRNPLL MISSION shRNA Lentiviral Transduction Particles
heterogeneous nuclear ribonucleoprotein L-like
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000075101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_138394.2-590s1c1
Sequence:CCGGCGACAGGCTCTAGTGGAATTTCTCGAGAAATTCCACTAGAGCCTGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075098    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_138394.2-1889s1c1
Sequence:CCGGGAGAAGAGCATGTTAGAATTTCTCGAGAAATTCTAACATGCTCTTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_138394.2-1103s1c1
Sequence:CCGGCCTTCTTCGTTTAGACATGATCTCGAGATCATGTCTAAACGAAGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_138394.2-834s1c1
Sequence:CCGGGCAAAGTGCAACGTATTGTTACTCGAGTAACAATACGTTGCACTTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_138394.2-1799s1c1
Sequence:CCGGGCACTGAATCACTATCAGATACTCGAGTATCTGATAGTGATTCAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138394.3-932s21c1
Sequence:CCGGGAATCCGCTTTATCCAATTACCTCGAGGTAATTGGATAAAGCGGATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428101    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138394.3-2347s21c1
Sequence:CCGGGCTAATTATCTGCAAGTATTTCTCGAGAAATACTTGCAGATAATTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)