EMAIL THIS PAGE TO A FRIEND

HNRNPM

heterogeneous nuclear ribonucleoprotein M

120 Gene Product Result for
Synonyms: CEAR HNRNPM4 HNRPM HNRPM4 HTGR1 NAGR1 hnRNP M
UniProtKB ID: P52272, Q15584, Q8WZ44, Q96H56, Q9BWL9, Q9Y492
Gene ID:
Human(4670) Summary: This gene belongs to the subfamily of ubiquitously expressed heterogeneous nuclear ribonucleoproteins (hnRNPs). The hnRNPs are RNA binding proteins and they complex with heterogeneous nuclear RNA (hnRNA). These proteins are associated with pre-mRNAs in the nucleus and appear to influence pre-mRNA processing and other aspects of mRNA metabolism and transport. While all of the hnRNPs are present in the nucleus, some seem to shuttle between the nucleus and the cytoplasm. The hnRNP proteins have distinct nucleic acid binding properties. The protein encoded by this gene has three repeats of quasi-RRM domains that bind to RNAs. This protein also constitutes a monomer of the N-acetylglucosamine-specific receptor which is postulated to trigger selective recycling of immature GlcNAc-bearing thyroglobulin molecules. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
Mouse(76936) heterogeneous nuclear ribonucleoprotein M
Rat(116655) heterogeneous nuclear ribonucleoprotein M
Zebrafish(555643) heterogeneous nuclear ribonucleoprotein M
domestic cat(101089840) heterogeneous nuclear ribonucleoprotein M
cow(515290) heterogeneous nuclear ribonucleoprotein M
dog(476725) heterogeneous nuclear ribonucleoprotein M
chicken(420054) heterogeneous nuclear ribonucleoprotein M
domestic guinea pig(100734014) heterogeneous nuclear ribonucleoprotein M
naked mole-rat(101702054) heterogeneous nuclear ribonucleoprotein M
sheep(101104061) heterogeneous nuclear ribonucleoprotein M
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029804 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029804 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029804 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005968 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005968 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005968 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU098771 MISSION® esiRNA esiRNA human HNRNPM (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005968 Rosetta Predictions human pricing
NM_031203 Rosetta Predictions human pricing
NM_001109911 Rosetta Predictions rat pricing
NM_053876 Rosetta Predictions rat pricing
NM_001109913 Rosetta Predictions mouse pricing
NM_029804 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005968 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00049126 predicted 2239
2 SASI_Hs01_00049128 predicted 1160
3 SASI_Hs02_00340644 predicted 256
4 SASI_Hs01_00049129 predicted 1032
5 SASI_Hs02_00340645 predicted 1176
6 SASI_Hs01_00049131 predicted 908
7 SASI_Hs02_00340646 predicted 1083
8 SASI_Hs02_00340647 predicted 1753
9 SASI_Hs01_00049134 predicted 1928
10 SASI_Hs02_00340648 predicted 1013
11 SASI_Hs01_00049125 predicted 1325
12 SASI_Hs01_00049127 predicted 1201
13 SASI_Hs01_00049130 predicted 2273
14 SASI_Hs01_00049132 predicted 2125
15 SASI_Hs01_00049133 predicted 1362
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031203 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00207072 predicted 2125
2 SASI_Hs01_00207074 predicted 1037
3 SASI_Hs02_00358603 predicted 259
4 SASI_Hs01_00207075 predicted 914
5 SASI_Hs02_00358604 predicted 1053
6 SASI_Hs01_00207077 predicted 794
7 SASI_Hs02_00358605 predicted 958
8 SASI_Hs02_00358606 predicted 1633
9 SASI_Hs01_00207080 predicted 1812
10 SASI_Hs02_00358607 predicted 901
11 SASI_Hs01_00207071 predicted 1212
12 SASI_Hs01_00207073 predicted 1087
13 SASI_Hs01_00207076 predicted 2159
14 SASI_Hs01_00207078 predicted 2004
15 SASI_Hs01_00207079 predicted 1246
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109911 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00250872 predicted 978
2 SASI_Rn02_00250873 predicted 203
3 SASI_Rn02_00250874 predicted 198
4 SASI_Rn02_00250875 predicted 196
5 SASI_Rn02_00250876 predicted 1417
6 SASI_Rn02_00250877 predicted 2172
7 SASI_Rn02_00250878 predicted 270
8 SASI_Rn02_00250879 predicted 1515
9 SASI_Rn02_00250880 predicted 1094
10 SASI_Rn02_00250881 predicted 972
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053876 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00057602 predicted 865
2 SASI_Rn02_00266777 predicted 196
3 SASI_Rn02_00266778 predicted 197
4 SASI_Rn02_00266779 predicted 195
5 SASI_Rn02_00266780 predicted 1299
6 SASI_Rn01_00057603 predicted 2056
7 SASI_Rn02_00266781 predicted 269
8 SASI_Rn01_00057605 predicted 1392
9 SASI_Rn01_00057607 predicted 976
10 SASI_Rn01_00057608 predicted 853
11 SASI_Rn01_00057604 predicted 267
12 SASI_Rn01_00057606 predicted 467
13 SASI_Rn01_00057609 predicted 623
14 SASI_Rn01_00057610 predicted 676
15 SASI_Rn01_00057611 predicted 528
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109913 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00304434 predicted 1944
2 SASI_Mm02_00304435 predicted 2117
3 SASI_Mm02_00304436 predicted 923
4 SASI_Mm02_00304437 predicted 1450
5 SASI_Mm02_00304438 predicted 889
6 SASI_Mm02_00304439 predicted 1052
7 SASI_Mm02_00304440 predicted 261
8 SASI_Mm02_00304441 predicted 855
9 SASI_Mm02_00304442 predicted 257
10 SASI_Mm02_00304443 predicted 1929
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029804 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00042145 predicted 2061
2 SASI_Mm02_00335970 predicted 2233
3 SASI_Mm01_00042146 predicted 1038
4 SASI_Mm01_00042147 predicted 1574
5 SASI_Mm01_00042148 predicted 1005
6 SASI_Mm01_00042149 predicted 1172
7 SASI_Mm01_00042150 predicted 262
8 SASI_Mm01_00042151 predicted 973
9 SASI_Mm02_00335971 predicted 260
10 SASI_Mm02_00335972 predicted 2040
11 SASI_Mm01_00042152 predicted 759
12 SASI_Mm01_00042153 predicted 688
13 SASI_Mm01_00042154 predicted 572
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029804
VALIDATED
HNRNPM MISSION shRNA Bacterial Glycerol Stock
heterogeneous nuclear ribonucleoprotein M
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000351871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_029804.3-773s21c1
Sequence:CCGGGCAGACATTCTGGAAGATAAACTCGAGTTTATCTTCCAGAATGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_029804.3-250s21c1
Sequence:CCGGCAATCGCTTTGAGCCATATTCCTCGAGGAATATGGCTCAAAGCGATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351872    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_029804.3-2345s21c1
Sequence:CCGGGCTGGATGTATAAAGATGTTTCTCGAGAAACATCTTTATACATCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_029804.1-1131s1c1
Sequence:CCGGGCCGAATAAATGAAATCCTAACTCGAGTTAGGATTTCATTTATTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029804.3-461s21c1
Sequence:CCGGGCTGAAGTTCTAAACAAGCATCTCGAGATGCTTGTTTAGAACTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029804.1-407s1c1
Sequence:CCGGGCTGAAGTTCTAAACAAGCATCTCGAGATGCTTGTTTAGAACTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123824    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_029804.1-2291s1c1
Sequence:CCGGGCTGGATGTATAAAGATGTTTCTCGAGAAACATCTTTATACATCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029804.1-560s1c1
Sequence:CCGGCCACCCAGTATCCTAAATAATCTCGAGATTATTTAGGATACTGGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029804.1-719s1c1
Sequence:CCGGGCAGACATTCTGGAAGATAAACTCGAGTTTATCTTCCAGAATGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029804
VALIDATED
HNRNPM MISSION shRNA shRNA Plasmid DNA
heterogeneous nuclear ribonucleoprotein M
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000351871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_029804.3-773s21c1
Sequence:CCGGGCAGACATTCTGGAAGATAAACTCGAGTTTATCTTCCAGAATGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_029804.3-250s21c1
Sequence:CCGGCAATCGCTTTGAGCCATATTCCTCGAGGAATATGGCTCAAAGCGATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000351872    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_029804.3-2345s21c1
Sequence:CCGGGCTGGATGTATAAAGATGTTTCTCGAGAAACATCTTTATACATCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_029804.1-1131s1c1
Sequence:CCGGGCCGAATAAATGAAATCCTAACTCGAGTTAGGATTTCATTTATTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000351870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029804.3-461s21c1
Sequence:CCGGGCTGAAGTTCTAAACAAGCATCTCGAGATGCTTGTTTAGAACTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029804.1-407s1c1
Sequence:CCGGGCTGAAGTTCTAAACAAGCATCTCGAGATGCTTGTTTAGAACTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123824    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_029804.1-2291s1c1
Sequence:CCGGGCTGGATGTATAAAGATGTTTCTCGAGAAACATCTTTATACATCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029804.1-560s1c1
Sequence:CCGGCCACCCAGTATCCTAAATAATCTCGAGATTATTTAGGATACTGGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029804.1-719s1c1
Sequence:CCGGGCAGACATTCTGGAAGATAAACTCGAGTTTATCTTCCAGAATGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029804
VALIDATED
HNRNPM MISSION shRNA Lentiviral Transduction Particles
heterogeneous nuclear ribonucleoprotein M
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000351871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_029804.3-773s21c1
Sequence:CCGGGCAGACATTCTGGAAGATAAACTCGAGTTTATCTTCCAGAATGTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_029804.3-250s21c1
Sequence:CCGGCAATCGCTTTGAGCCATATTCCTCGAGGAATATGGCTCAAAGCGATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351872    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_029804.3-2345s21c1
Sequence:CCGGGCTGGATGTATAAAGATGTTTCTCGAGAAACATCTTTATACATCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_029804.1-1131s1c1
Sequence:CCGGGCCGAATAAATGAAATCCTAACTCGAGTTAGGATTTCATTTATTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029804.3-461s21c1
Sequence:CCGGGCTGAAGTTCTAAACAAGCATCTCGAGATGCTTGTTTAGAACTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029804.1-407s1c1
Sequence:CCGGGCTGAAGTTCTAAACAAGCATCTCGAGATGCTTGTTTAGAACTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123824    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_029804.1-2291s1c1
Sequence:CCGGGCTGGATGTATAAAGATGTTTCTCGAGAAACATCTTTATACATCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029804.1-560s1c1
Sequence:CCGGCCACCCAGTATCCTAAATAATCTCGAGATTATTTAGGATACTGGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029804.1-719s1c1
Sequence:CCGGGCAGACATTCTGGAAGATAAACTCGAGTTTATCTTCCAGAATGTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005968
VALIDATED
HNRNPM MISSION shRNA Bacterial Glycerol Stock
heterogeneous nuclear ribonucleoprotein M
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005968.3-2253s21c1
Sequence:CCGGCGAATTGATAGAAACGCTTAACTCGAGTTAAGCGTTTCTATCAATTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005968.3-478s21c1
Sequence:CCGGACAAGCATAGTCTGAGCGGAACTCGAGTTCCGCTCAGACTATGCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005968.3-294s21c1
Sequence:CCGGAGAGCCTTCATTACAAACATACTCGAGTATGTTTGTAATGAAGGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005968.3-850s21c1
Sequence:CCGGCTGTGCAAGCTATATCTATGTCTCGAGACATAGATATAGCTTGCACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005968.x-444s1c1
Sequence:CCGGAGAGCCTTCATTACAAACATACTCGAGTATGTTTGTAATGAAGGCTCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005968.x-628s1c1
Sequence:CCGGACAAGCATAGTCTGAGCGGAACTCGAGTTCCGCTCAGACTATGCTTGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005968.x-1373s1c1
Sequence:CCGGGAGAGGAGAGATCATTGCAAACTCGAGTTTGCAATGATCTCTCCTCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005968.x-710s1c1
Sequence:CCGGGATGGCTACGACTGGTGGGATCTCGAGATCCCACCAGTCGTAGCCATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005968.x-1000s1c1
Sequence:CCGGCTGTGCAAGCTATATCTATGTCTCGAGACATAGATATAGCTTGCACAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005968
VALIDATED
HNRNPM MISSION shRNA shRNA Plasmid DNA
heterogeneous nuclear ribonucleoprotein M
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005968.3-2253s21c1
Sequence:CCGGCGAATTGATAGAAACGCTTAACTCGAGTTAAGCGTTTCTATCAATTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005968.3-478s21c1
Sequence:CCGGACAAGCATAGTCTGAGCGGAACTCGAGTTCCGCTCAGACTATGCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005968.3-294s21c1
Sequence:CCGGAGAGCCTTCATTACAAACATACTCGAGTATGTTTGTAATGAAGGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005968.3-850s21c1
Sequence:CCGGCTGTGCAAGCTATATCTATGTCTCGAGACATAGATATAGCTTGCACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005968.x-444s1c1
Sequence:CCGGAGAGCCTTCATTACAAACATACTCGAGTATGTTTGTAATGAAGGCTCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005968.x-628s1c1
Sequence:CCGGACAAGCATAGTCTGAGCGGAACTCGAGTTCCGCTCAGACTATGCTTGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005968.x-1373s1c1
Sequence:CCGGGAGAGGAGAGATCATTGCAAACTCGAGTTTGCAATGATCTCTCCTCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005968.x-710s1c1
Sequence:CCGGGATGGCTACGACTGGTGGGATCTCGAGATCCCACCAGTCGTAGCCATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005968.x-1000s1c1
Sequence:CCGGCTGTGCAAGCTATATCTATGTCTCGAGACATAGATATAGCTTGCACAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005968
VALIDATED
HNRNPM MISSION shRNA Lentiviral Transduction Particles
heterogeneous nuclear ribonucleoprotein M
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005968.3-2253s21c1
Sequence:CCGGCGAATTGATAGAAACGCTTAACTCGAGTTAAGCGTTTCTATCAATTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005968.3-478s21c1
Sequence:CCGGACAAGCATAGTCTGAGCGGAACTCGAGTTCCGCTCAGACTATGCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005968.3-294s21c1
Sequence:CCGGAGAGCCTTCATTACAAACATACTCGAGTATGTTTGTAATGAAGGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005968.3-850s21c1
Sequence:CCGGCTGTGCAAGCTATATCTATGTCTCGAGACATAGATATAGCTTGCACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005968.x-444s1c1
Sequence:CCGGAGAGCCTTCATTACAAACATACTCGAGTATGTTTGTAATGAAGGCTCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005968.x-628s1c1
Sequence:CCGGACAAGCATAGTCTGAGCGGAACTCGAGTTCCGCTCAGACTATGCTTGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005968.x-1373s1c1
Sequence:CCGGGAGAGGAGAGATCATTGCAAACTCGAGTTTGCAATGATCTCTCCTCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005968.x-710s1c1
Sequence:CCGGGATGGCTACGACTGGTGGGATCTCGAGATCCCACCAGTCGTAGCCATCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005968.x-1000s1c1
Sequence:CCGGCTGTGCAAGCTATATCTATGTCTCGAGACATAGATATAGCTTGCACAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)