EMAIL THIS PAGE TO A FRIEND

HNRNPR

heterogeneous nuclear ribonucleoprotein R

123 Gene Product Result for
Synonyms: HNRPR hnRNP R hnRNP-R
UniProtKB ID: O43390, Q2L7G6, Q5TEH1, Q9BV64
Gene ID:
Human(10236) Summary: This gene belongs to the subfamily of ubiquitously expressed heterogeneous nuclear ribonucleoproteins (hnRNPs). The hnRNPs are RNA binding proteins and they complex with heterogeneous nuclear RNA (hnRNA). These proteins are associated with pre-mRNAs in the nucleus and appear to influence pre-mRNA processing and other aspects of mRNA metabolism and transport. While all of the hnRNPs are present in the nucleus, some seem to shuttle between the nucleus and the cytoplasm. The hnRNP proteins have distinct nucleic acid binding properties. The protein encoded by this gene has three repeats of quasi-RRM domains that bind to RNAs and also contains a nuclear localization motif. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(74326) heterogeneous nuclear ribonucleoprotein R
Rat(319110) heterogeneous nuclear ribonucleoprotein R
Zebrafish(406735) heterogeneous nuclear ribonucleoprotein R
dog(478192) heterogeneous nuclear ribonucleoprotein R
Horse(100071619) heterogeneous nuclear ribonucleoprotein R
cow(512479) heterogeneous nuclear ribonucleoprotein R
domestic cat(101097329) heterogeneous nuclear ribonucleoprotein R
chicken(419570) heterogeneous nuclear ribonucleoprotein R
sheep(101121577) heterogeneous nuclear ribonucleoprotein R
domestic guinea pig(100715240) heterogeneous nuclear ribonucleoprotein R
naked mole-rat(101708545) heterogeneous nuclear ribonucleoprotein R
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2700924 Anti-HNRNPR (N-terminal) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunofluorescence, immunoprecipitation (IP), western blot pricing
HPA026092 Anti-HNRNPR antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2101057 Anti-HNRNPR antibody produced in rabbit affinity isolated antibody horse, rabbit, bovine, canine, guinea pig, mouse, human, rat
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028871 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028871 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028871 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005826 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005826 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005826 MISSION® shRNA Lentiviral Transduction Particles human pricing

Related Products

Product # Description Species Add to Cart
 
03-100 RIPAb+™ hnRNP M1-M4 pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001102397 Rosetta Predictions human pricing
NM_001102398 Rosetta Predictions human pricing
NM_001102399 Rosetta Predictions human pricing
NM_005826 Rosetta Predictions human pricing
NM_175603 Rosetta Predictions rat pricing
NM_028871 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001102397 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00323053 predicted 2280
2 SASI_Hs02_00323054 predicted 2254
3 SASI_Hs02_00323055 predicted 1139
4 SASI_Hs02_00323056 predicted 387
5 SASI_Hs02_00323057 predicted 1041
6 SASI_Hs02_00323058 predicted 1237
7 SASI_Hs02_00323059 predicted 1099
8 SASI_Hs02_00323060 predicted 2251
9 SASI_Hs02_00323061 predicted 2253
10 SASI_Hs02_00323062 predicted 2232
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001102398 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00323063 predicted 2420
2 SASI_Hs02_00323064 predicted 723
3 SASI_Hs02_00323065 predicted 555
4 SASI_Hs02_00323066 predicted 727
5 SASI_Hs02_00323067 predicted 1222
6 SASI_Hs02_00323068 predicted 619
7 SASI_Hs02_00323069 predicted 2431
8 SASI_Hs02_00323070 predicted 2426
9 SASI_Hs02_00323071 predicted 2412
10 SASI_Hs02_00323072 predicted 592
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001102399 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00323073 predicted 2259
2 SASI_Hs02_00323074 predicted 555
3 SASI_Hs02_00323075 predicted 387
4 SASI_Hs02_00323076 predicted 553
5 SASI_Hs02_00323077 predicted 1052
6 SASI_Hs02_00323078 predicted 451
7 SASI_Hs02_00323079 predicted 2264
8 SASI_Hs02_00323080 predicted 2257
9 SASI_Hs02_00323081 predicted 2248
10 SASI_Hs02_00323082 predicted 428
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005826 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00340351 predicted 2414
2 SASI_Hs01_00111478 predicted 724
3 SASI_Hs01_00111481 predicted 557
4 SASI_Hs01_00111482 predicted 727
5 SASI_Hs01_00111483 predicted 1211
6 SASI_Hs01_00111485 predicted 611
7 SASI_Hs02_00340352 predicted 2420
8 SASI_Hs02_00340353 predicted 2420
9 SASI_Hs02_00340354 predicted 2397
10 SASI_Hs01_00111487 predicted 594
11 SASI_Hs01_00111479 predicted 349
12 SASI_Hs01_00111480 predicted 259
13 SASI_Hs01_00111484 predicted 702
14 SASI_Hs01_00111486 predicted 707
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175603 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00042458 predicted 1900
2 SASI_Rn01_00042459 predicted 1988
3 SASI_Rn01_00042460 predicted 778
4 SASI_Rn01_00042461 predicted 666
5 SASI_Rn01_00042462 predicted 256
6 SASI_Rn01_00042463 predicted 2076
7 SASI_Rn01_00042464 predicted 1072
8 SASI_Rn01_00042465 predicted 1913
9 SASI_Rn01_00042466 predicted 693
10 SASI_Rn01_00042467 predicted 537
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028871 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00142699 predicted 2066
2 SASI_Mm01_00142700 predicted 1081
3 SASI_Mm01_00142702 predicted 1948
4 SASI_Mm01_00142703 predicted 2131
5 SASI_Mm01_00142704 predicted 796
6 SASI_Mm01_00142705 predicted 298
7 SASI_Mm01_00142706 predicted 833
8 SASI_Mm01_00142707 predicted 520
9 SASI_Mm01_00142708 predicted 455
10 SASI_Mm02_00334548 predicted 881
11 SASI_Mm01_00142701 predicted 266
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028871
VALIDATED
HNRNPR MISSION shRNA Bacterial Glycerol Stock
heterogeneous nuclear ribonucleoprotein R
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000331893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028871.1-1702s21c1
Sequence:CCGGCAAGAGGTAGAGCTGGCTATTCTCGAGAATAGCCAGCTCTACCTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028871.1-332s21c1
Sequence:CCGGCGATGCTCTCAGGGAGTTTAACTCGAGTTAAACTCCCTGAGAGCATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028871.1-1593s21c1
Sequence:CCGGGAAGATCCCTACTACGGCTATCTCGAGATAGCCGTAGTAGGGATCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308978    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028871.1-2109s21c1
Sequence:CCGGGCGTAACTGTTTCATCTTTAACTCGAGTTAAAGATGAAACAGTTACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028871.1-1420s21c1
Sequence:CCGGGCACTGCGTATGAAGATTATTCTCGAGAATAATCTTCATACGCAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112075    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028871.1-2109s1c1
Sequence:CCGGGCGTAACTGTTTCATCTTTAACTCGAGTTAAAGATGAAACAGTTACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028871.1-1593s1c1
Sequence:CCGGGAAGATCCCTACTACGGCTATCTCGAGATAGCCGTAGTAGGGATCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028871.1-1420s1c1
Sequence:CCGGGCACTGCGTATGAAGATTATTCTCGAGAATAATCTTCATACGCAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028871.1-332s1c1
Sequence:CCGGCGATGCTCTCAGGGAGTTTAACTCGAGTTAAACTCCCTGAGAGCATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028871.1-1702s1c1
Sequence:CCGGCAAGAGGTAGAGCTGGCTATTCTCGAGAATAGCCAGCTCTACCTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028871
VALIDATED
HNRNPR MISSION shRNA shRNA Plasmid DNA
heterogeneous nuclear ribonucleoprotein R
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000331893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028871.1-1702s21c1
Sequence:CCGGCAAGAGGTAGAGCTGGCTATTCTCGAGAATAGCCAGCTCTACCTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028871.1-332s21c1
Sequence:CCGGCGATGCTCTCAGGGAGTTTAACTCGAGTTAAACTCCCTGAGAGCATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028871.1-1593s21c1
Sequence:CCGGGAAGATCCCTACTACGGCTATCTCGAGATAGCCGTAGTAGGGATCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308978    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028871.1-2109s21c1
Sequence:CCGGGCGTAACTGTTTCATCTTTAACTCGAGTTAAAGATGAAACAGTTACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028871.1-1420s21c1
Sequence:CCGGGCACTGCGTATGAAGATTATTCTCGAGAATAATCTTCATACGCAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112075    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028871.1-2109s1c1
Sequence:CCGGGCGTAACTGTTTCATCTTTAACTCGAGTTAAAGATGAAACAGTTACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028871.1-1593s1c1
Sequence:CCGGGAAGATCCCTACTACGGCTATCTCGAGATAGCCGTAGTAGGGATCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028871.1-1420s1c1
Sequence:CCGGGCACTGCGTATGAAGATTATTCTCGAGAATAATCTTCATACGCAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028871.1-332s1c1
Sequence:CCGGCGATGCTCTCAGGGAGTTTAACTCGAGTTAAACTCCCTGAGAGCATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028871.1-1702s1c1
Sequence:CCGGCAAGAGGTAGAGCTGGCTATTCTCGAGAATAGCCAGCTCTACCTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028871
VALIDATED
HNRNPR MISSION shRNA Lentiviral Transduction Particles
heterogeneous nuclear ribonucleoprotein R
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000331893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028871.1-1702s21c1
Sequence:CCGGCAAGAGGTAGAGCTGGCTATTCTCGAGAATAGCCAGCTCTACCTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028871.1-332s21c1
Sequence:CCGGCGATGCTCTCAGGGAGTTTAACTCGAGTTAAACTCCCTGAGAGCATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028871.1-1593s21c1
Sequence:CCGGGAAGATCCCTACTACGGCTATCTCGAGATAGCCGTAGTAGGGATCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308978    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028871.1-2109s21c1
Sequence:CCGGGCGTAACTGTTTCATCTTTAACTCGAGTTAAAGATGAAACAGTTACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028871.1-1420s21c1
Sequence:CCGGGCACTGCGTATGAAGATTATTCTCGAGAATAATCTTCATACGCAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112075    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028871.1-2109s1c1
Sequence:CCGGGCGTAACTGTTTCATCTTTAACTCGAGTTAAAGATGAAACAGTTACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028871.1-1593s1c1
Sequence:CCGGGAAGATCCCTACTACGGCTATCTCGAGATAGCCGTAGTAGGGATCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028871.1-1420s1c1
Sequence:CCGGGCACTGCGTATGAAGATTATTCTCGAGAATAATCTTCATACGCAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028871.1-332s1c1
Sequence:CCGGCGATGCTCTCAGGGAGTTTAACTCGAGTTAAACTCCCTGAGAGCATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028871.1-1702s1c1
Sequence:CCGGCAAGAGGTAGAGCTGGCTATTCTCGAGAATAGCCAGCTCTACCTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005826
VALIDATED
HNRNPR MISSION shRNA Bacterial Glycerol Stock
heterogeneous nuclear ribonucleoprotein R
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000235502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_005826.3-1553s21c1
Sequence:CCGGACGGCTATGAAGATTACTATGCTCGAGCATAGTAATCTTCATAGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_005826.3-970s21c1
Sequence:CCGGGAGGGTTTGGTGGACGTTATTCTCGAGAATAACGTCCACCAAACCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235506    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_005826.3-2302s21c1
Sequence:CCGGTTATCGTTTCAGGCTTCATTTCTCGAGAAATGAAGCCTGAAACGATAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_005826.3-549s21c1
Sequence:CCGGGCTTGAGAGAACTGGTTATACCTCGAGGTATAACCAGTTCTCTCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005826.3-729s21c1
Sequence:CCGGCATTTGGGATCTACGTCTTATCTCGAGATAAGACGTAGATCCCAAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005826.3-982s21c1
Sequence:CCGGGACGTTATTCTCTATCATCAACTCGAGTTGATGATAGAGAATAACGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001238    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005826.x-2178s1c1
Sequence:CCGGCTCTTGGACATTATTGGGCTTCTCGAGAAGCCCAATAATGTCCAAGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005826.x-172s1c1
Sequence:CCGGGAACACTACAAGACACTGATACTCGAGTATCAGTGTCTTGTAGTGTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005826.x-253s1c1
Sequence:CCGGGTAGCTTATGTCGATCTTGATCTCGAGATCAAGATCGACATAAGCTACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_005826.x-913s1c1
Sequence:CCGGGACGTTATTCTCTATCATCAACTCGAGTTGATGATAGAGAATAACGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005826.x-607s1c1
Sequence:CCGGCCAAGGGATTTATATGAGGATCTCGAGATCCTCATATAAATCCCTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005826
VALIDATED
HNRNPR MISSION shRNA shRNA Plasmid DNA
heterogeneous nuclear ribonucleoprotein R
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000235502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_005826.3-1553s21c1
Sequence:CCGGACGGCTATGAAGATTACTATGCTCGAGCATAGTAATCTTCATAGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_005826.3-970s21c1
Sequence:CCGGGAGGGTTTGGTGGACGTTATTCTCGAGAATAACGTCCACCAAACCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235506    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_005826.3-2302s21c1
Sequence:CCGGTTATCGTTTCAGGCTTCATTTCTCGAGAAATGAAGCCTGAAACGATAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_005826.3-549s21c1
Sequence:CCGGGCTTGAGAGAACTGGTTATACCTCGAGGTATAACCAGTTCTCTCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005826.3-729s21c1
Sequence:CCGGCATTTGGGATCTACGTCTTATCTCGAGATAAGACGTAGATCCCAAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005826.3-982s21c1
Sequence:CCGGGACGTTATTCTCTATCATCAACTCGAGTTGATGATAGAGAATAACGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001238    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005826.x-2178s1c1
Sequence:CCGGCTCTTGGACATTATTGGGCTTCTCGAGAAGCCCAATAATGTCCAAGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005826.x-172s1c1
Sequence:CCGGGAACACTACAAGACACTGATACTCGAGTATCAGTGTCTTGTAGTGTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005826.x-253s1c1
Sequence:CCGGGTAGCTTATGTCGATCTTGATCTCGAGATCAAGATCGACATAAGCTACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_005826.x-913s1c1
Sequence:CCGGGACGTTATTCTCTATCATCAACTCGAGTTGATGATAGAGAATAACGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005826.x-607s1c1
Sequence:CCGGCCAAGGGATTTATATGAGGATCTCGAGATCCTCATATAAATCCCTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005826
VALIDATED
HNRNPR MISSION shRNA Lentiviral Transduction Particles
heterogeneous nuclear ribonucleoprotein R
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000235502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_005826.3-1553s21c1
Sequence:CCGGACGGCTATGAAGATTACTATGCTCGAGCATAGTAATCTTCATAGCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_005826.3-970s21c1
Sequence:CCGGGAGGGTTTGGTGGACGTTATTCTCGAGAATAACGTCCACCAAACCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235506    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_005826.3-2302s21c1
Sequence:CCGGTTATCGTTTCAGGCTTCATTTCTCGAGAAATGAAGCCTGAAACGATAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_005826.3-549s21c1
Sequence:CCGGGCTTGAGAGAACTGGTTATACCTCGAGGTATAACCAGTTCTCTCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005826.3-729s21c1
Sequence:CCGGCATTTGGGATCTACGTCTTATCTCGAGATAAGACGTAGATCCCAAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005826.3-982s21c1
Sequence:CCGGGACGTTATTCTCTATCATCAACTCGAGTTGATGATAGAGAATAACGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001238    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005826.x-2178s1c1
Sequence:CCGGCTCTTGGACATTATTGGGCTTCTCGAGAAGCCCAATAATGTCCAAGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005826.x-172s1c1
Sequence:CCGGGAACACTACAAGACACTGATACTCGAGTATCAGTGTCTTGTAGTGTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005826.x-253s1c1
Sequence:CCGGGTAGCTTATGTCGATCTTGATCTCGAGATCAAGATCGACATAAGCTACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_005826.x-913s1c1
Sequence:CCGGGACGTTATTCTCTATCATCAACTCGAGTTGATGATAGAGAATAACGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005826.x-607s1c1
Sequence:CCGGCCAAGGGATTTATATGAGGATCTCGAGATCCTCATATAAATCCCTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)