EMAIL THIS PAGE TO A FRIEND

HNRNPU

heterogeneous nuclear ribonucleoprotein U (scaffold attachment factor A)

180 Gene Product Result for
Synonyms: HNRPU SAF-A U21.1 hnRNP U
UniProtKB ID: Q00839, O75507, Q8N174, Q96HY9, Q9BQ09
Gene ID:
Human(3192) Summary: This gene belongs to the subfamily of ubiquitously expressed heterogeneous nuclear ribonucleoproteins (hnRNPs). The hnRNPs are RNA binding proteins and they form complexes with heterogeneous nuclear RNA (hnRNA). These proteins are associated with pre-mRNAs in the nucleus and appear to influence pre-mRNA processing and other aspects of mRNA metabolism and transport. While all of the hnRNPs are present in the nucleus, some seem to shuttle between the nucleus and the cytoplasm. The hnRNP proteins have distinct nucleic acid binding properties. The protein encoded by this gene contains a RNA binding domain and scaffold-associated region (SAR)-specific bipartite DNA-binding domain. This protein is also thought to be involved in the packaging of hnRNA into large ribonucleoprotein complexes. During apoptosis, this protein is cleaved in a caspase-dependent way. Cleavage occurs at the SALD site, resulting in a loss of DNA-binding activity and a concomitant detachment of this protein from nuclear structural sites. But this cleavage does not affect the function of the encoded protein in RNA metabolism. At least two alternatively spliced transcript variants have been identified for this gene. [provided by RefSeq, Jul 2008]
Mouse(51810) heterogeneous nuclear ribonucleoprotein U
Rat(117280) heterogeneous nuclear ribonucleoprotein U
chicken(421492) heterogeneous nuclear ribonucleoprotein U (scaffold attachment factor A)
dog(480100) heterogeneous nuclear ribonucleoprotein U (scaffold attachment factor A)
cow(539950) heterogeneous nuclear ribonucleoprotein U (scaffold attachment factor A)
Horse(100062482) heterogeneous nuclear ribonucleoprotein U (scaffold attachment factor A)
domestic cat(101091585) heterogeneous nuclear ribonucleoprotein U (scaffold attachment factor A)
domestic guinea pig(100725944) heterogeneous nuclear ribonucleoprotein U (scaffold attachment factor A)
naked mole-rat(101726650) heterogeneous nuclear ribonucleoprotein U (scaffold attachment factor A)
sheep(101107118) heterogeneous nuclear ribonucleoprotein U (scaffold attachment factor A)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016805 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016805 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016805 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_031844 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031844 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031844 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004501 Rosetta Predictions human pricing
NM_031844 Rosetta Predictions human pricing
NM_057139 Rosetta Predictions rat pricing
XM_579596 Rosetta Predictions rat pricing
NM_016805 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004501 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00063626 predicted 1245
2 SASI_Hs01_00063629 predicted 2398
3 SASI_Hs01_00063630 predicted 1222
4 SASI_Hs01_00063631 predicted 1484
5 SASI_Hs01_00063632 predicted 2293
6 SASI_Hs01_00063633 predicted 1640
7 SASI_Hs01_00063634 predicted 1741
8 SASI_Hs01_00063635 predicted 1260
9 SASI_Hs02_00337758 predicted 1322
10 SASI_Hs02_00337759 predicted 2068
11 SASI_Hs01_00063627 predicted 1519
12 SASI_Hs01_00063628 predicted 1796
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031844 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00153125 predicted 1301
2 SASI_Hs01_00153128 predicted 2448
3 SASI_Hs01_00153129 predicted 1279
4 SASI_Hs01_00153130 predicted 1543
5 SASI_Hs01_00153131 predicted 2348
6 SASI_Hs01_00153132 predicted 1703
7 SASI_Hs01_00153133 predicted 1801
8 SASI_Hs01_00153134 predicted 1317
9 SASI_Hs02_00358943 predicted 1377
10 SASI_Hs02_00358944 predicted 2128
11 SASI_Hs01_00153126 predicted 1576
12 SASI_Hs01_00153127 predicted 1854
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_057139 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00107071 predicted 940
2 SASI_Rn01_00107072 predicted 1190
3 SASI_Rn01_00107073 predicted 1375
4 SASI_Rn01_00107075 predicted 834
5 SASI_Rn01_00107076 predicted 2423
6 SASI_Rn01_00107077 predicted 1568
7 SASI_Rn01_00107078 predicted 893
8 SASI_Rn01_00107079 predicted 1433
9 SASI_Rn01_00107080 predicted 1418
10 SASI_Rn02_00267091 predicted 221
11 SASI_Rn01_00107074 predicted 2202
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579596 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00180810 predicted 923
2 SASI_Rn01_00180811 predicted 1172
3 SASI_Rn01_00180812 predicted 1093
4 SASI_Rn01_00180813 predicted 1356
5 SASI_Rn01_00180814 predicted 1696
6 SASI_Rn01_00180815 predicted 824
7 SASI_Rn01_00180816 predicted 2398
8 SASI_Rn01_00180817 predicted 1557
9 SASI_Rn01_00180818 predicted 878
10 SASI_Rn01_00180819 predicted 1414
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016805 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00179155 predicted 1423
2 SASI_Mm01_00179156 predicted 997
3 SASI_Mm01_00179157 predicted 1241
4 SASI_Mm01_00179158 predicted 1726
5 SASI_Mm01_00179159 predicted 1626
6 SASI_Mm01_00179160 predicted 1389
7 SASI_Mm02_00323593 predicted 1580
8 SASI_Mm01_00179161 predicted 1277
9 SASI_Mm02_00323594 predicted 2469
10 SASI_Mm02_00323595 predicted 2442
11 SASI_Mm01_00179162 predicted 1512
12 SASI_Mm01_00179163 predicted 2254
13 SASI_Mm01_00179164 predicted 1170
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016805
VALIDATED
HNRNPU MISSION shRNA Bacterial Glycerol Stock
heterogeneous nuclear ribonucleoprotein U (scaffold attachment factor A)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000120017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016805.1-1642s1c1
Sequence:CCGGCCTGGGAAATACAACATTCTTCTCGAGAAGAATGTTGTATTTCCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016805.1-935s1c1
Sequence:CCGGCAGTGGTTTGTCTTGATACTTCTCGAGAAGTATCAAGACAAACCACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016805.1-2147s1c1
Sequence:CCGGGCAATAAGAATAAGAGTGGCACTCGAGTGCCACTCTTATTCTTATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016805.1-1428s1c1
Sequence:CCGGCCATAACTGTGCAGTTGAATTCTCGAGAATTCAACTGCACAGTTATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016805.1-2439s1c1
Sequence:CCGGGCGAGGAAATAATCGTGGCTACTCGAGTAGCCACGATTATTTCCTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016805.2-1851s21c1
Sequence:CCGGTGCCCGTAAGAAGCGAAATTTCTCGAGAAATTTCGCTTCTTACGGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016805.2-2314s21c1
Sequence:CCGGGGGAATCGTGGTGGATATAATCTCGAGATTATATCCACCACGATTCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016805.2-1491s21c1
Sequence:CCGGCCATAACTGTGCAGTTGAATTCTCGAGAATTCAACTGCACAGTTATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016805.2-894s21c1
Sequence:CCGGAGATCATGGCCGAGGGTATTTCTCGAGAAATACCCTCGGCCATGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340591    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016805.2-2740s21c1
Sequence:CCGGAGAAGCTTTGTGGGTTGATTTCTCGAGAAATCAACCCACAAAGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016805
VALIDATED
HNRNPU MISSION shRNA shRNA Plasmid DNA
heterogeneous nuclear ribonucleoprotein U (scaffold attachment factor A)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000120017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016805.1-1642s1c1
Sequence:CCGGCCTGGGAAATACAACATTCTTCTCGAGAAGAATGTTGTATTTCCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016805.1-935s1c1
Sequence:CCGGCAGTGGTTTGTCTTGATACTTCTCGAGAAGTATCAAGACAAACCACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016805.1-2147s1c1
Sequence:CCGGGCAATAAGAATAAGAGTGGCACTCGAGTGCCACTCTTATTCTTATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016805.1-1428s1c1
Sequence:CCGGCCATAACTGTGCAGTTGAATTCTCGAGAATTCAACTGCACAGTTATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016805.1-2439s1c1
Sequence:CCGGGCGAGGAAATAATCGTGGCTACTCGAGTAGCCACGATTATTTCCTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016805.2-1851s21c1
Sequence:CCGGTGCCCGTAAGAAGCGAAATTTCTCGAGAAATTTCGCTTCTTACGGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016805.2-2314s21c1
Sequence:CCGGGGGAATCGTGGTGGATATAATCTCGAGATTATATCCACCACGATTCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016805.2-1491s21c1
Sequence:CCGGCCATAACTGTGCAGTTGAATTCTCGAGAATTCAACTGCACAGTTATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016805.2-894s21c1
Sequence:CCGGAGATCATGGCCGAGGGTATTTCTCGAGAAATACCCTCGGCCATGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340591    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016805.2-2740s21c1
Sequence:CCGGAGAAGCTTTGTGGGTTGATTTCTCGAGAAATCAACCCACAAAGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016805
VALIDATED
HNRNPU MISSION shRNA Lentiviral Transduction Particles
heterogeneous nuclear ribonucleoprotein U (scaffold attachment factor A)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000120017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016805.1-1642s1c1
Sequence:CCGGCCTGGGAAATACAACATTCTTCTCGAGAAGAATGTTGTATTTCCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016805.1-935s1c1
Sequence:CCGGCAGTGGTTTGTCTTGATACTTCTCGAGAAGTATCAAGACAAACCACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016805.1-2147s1c1
Sequence:CCGGGCAATAAGAATAAGAGTGGCACTCGAGTGCCACTCTTATTCTTATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016805.1-1428s1c1
Sequence:CCGGCCATAACTGTGCAGTTGAATTCTCGAGAATTCAACTGCACAGTTATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016805.1-2439s1c1
Sequence:CCGGGCGAGGAAATAATCGTGGCTACTCGAGTAGCCACGATTATTTCCTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016805.2-1851s21c1
Sequence:CCGGTGCCCGTAAGAAGCGAAATTTCTCGAGAAATTTCGCTTCTTACGGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016805.2-2314s21c1
Sequence:CCGGGGGAATCGTGGTGGATATAATCTCGAGATTATATCCACCACGATTCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016805.2-1491s21c1
Sequence:CCGGCCATAACTGTGCAGTTGAATTCTCGAGAATTCAACTGCACAGTTATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016805.2-894s21c1
Sequence:CCGGAGATCATGGCCGAGGGTATTTCTCGAGAAATACCCTCGGCCATGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340591    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016805.2-2740s21c1
Sequence:CCGGAGAAGCTTTGTGGGTTGATTTCTCGAGAAATCAACCCACAAAGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031844
VALIDATED
HNRNPU MISSION shRNA Bacterial Glycerol Stock
heterogeneous nuclear ribonucleoprotein U (scaffold attachment factor A)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000001297    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_031844.x-2910s1c1
Sequence:CCGGCGATAAGAGAATGTGTCAGTACTCGAGTACTGACACATTCTCTTATCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_031844.x-1380s1c1
Sequence:CCGGGCAACTGTGAGACTGAAGATTCTCGAGAATCTTCAGTCTCACAGTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_031844.x-2551s1c1
Sequence:CCGGAGGGAACTACAACCAGAACTTCTCGAGAAGTTCTGGTTGTAGTTCCCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_031844.x-1132s1c1
Sequence:CCGGCAGTGCTTCTTCCCTTACAATCTCGAGATTGTAAGGGAAGAAGCACTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_031844.2-1136s21c1
Sequence:CCGGCAGTGCTTCTTCCCTTACAATCTCGAGATTGTAAGGGAAGAAGCACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320515    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031844.2-3151s21c1
Sequence:CCGGGACTCTGTACTGCTCATATTACTCGAGTAATATGAGCAGTACAGAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_031844.2-1384s21c1
Sequence:CCGGGCAACTGTGAGACTGAAGATTCTCGAGAATCTTCAGTCTCACAGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_031844.2-971s21c1
Sequence:CCGGAGATCATGGCCGTGGATATTTCTCGAGAAATATCCACGGCCATGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_031844.2-1928s21c1
Sequence:CCGGTGCCCGAAAGAAGCGAAATTTCTCGAGAAATTTCGCTTCTTTCGGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031844
VALIDATED
HNRNPU MISSION shRNA shRNA Plasmid DNA
heterogeneous nuclear ribonucleoprotein U (scaffold attachment factor A)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000001297    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_031844.x-2910s1c1
Sequence:CCGGCGATAAGAGAATGTGTCAGTACTCGAGTACTGACACATTCTCTTATCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_031844.x-1380s1c1
Sequence:CCGGGCAACTGTGAGACTGAAGATTCTCGAGAATCTTCAGTCTCACAGTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_031844.x-2551s1c1
Sequence:CCGGAGGGAACTACAACCAGAACTTCTCGAGAAGTTCTGGTTGTAGTTCCCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_031844.x-1132s1c1
Sequence:CCGGCAGTGCTTCTTCCCTTACAATCTCGAGATTGTAAGGGAAGAAGCACTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_031844.2-1136s21c1
Sequence:CCGGCAGTGCTTCTTCCCTTACAATCTCGAGATTGTAAGGGAAGAAGCACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320515    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031844.2-3151s21c1
Sequence:CCGGGACTCTGTACTGCTCATATTACTCGAGTAATATGAGCAGTACAGAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_031844.2-1384s21c1
Sequence:CCGGGCAACTGTGAGACTGAAGATTCTCGAGAATCTTCAGTCTCACAGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_031844.2-971s21c1
Sequence:CCGGAGATCATGGCCGTGGATATTTCTCGAGAAATATCCACGGCCATGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_031844.2-1928s21c1
Sequence:CCGGTGCCCGAAAGAAGCGAAATTTCTCGAGAAATTTCGCTTCTTTCGGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031844
VALIDATED
HNRNPU MISSION shRNA Lentiviral Transduction Particles
heterogeneous nuclear ribonucleoprotein U (scaffold attachment factor A)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000001297    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_031844.x-2910s1c1
Sequence:CCGGCGATAAGAGAATGTGTCAGTACTCGAGTACTGACACATTCTCTTATCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_031844.x-1380s1c1
Sequence:CCGGGCAACTGTGAGACTGAAGATTCTCGAGAATCTTCAGTCTCACAGTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_031844.x-2551s1c1
Sequence:CCGGAGGGAACTACAACCAGAACTTCTCGAGAAGTTCTGGTTGTAGTTCCCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_031844.x-1132s1c1
Sequence:CCGGCAGTGCTTCTTCCCTTACAATCTCGAGATTGTAAGGGAAGAAGCACTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_031844.2-1136s21c1
Sequence:CCGGCAGTGCTTCTTCCCTTACAATCTCGAGATTGTAAGGGAAGAAGCACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320515    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031844.2-3151s21c1
Sequence:CCGGGACTCTGTACTGCTCATATTACTCGAGTAATATGAGCAGTACAGAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_031844.2-1384s21c1
Sequence:CCGGGCAACTGTGAGACTGAAGATTCTCGAGAATCTTCAGTCTCACAGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_031844.2-971s21c1
Sequence:CCGGAGATCATGGCCGTGGATATTTCTCGAGAAATATCCACGGCCATGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_031844.2-1928s21c1
Sequence:CCGGTGCCCGAAAGAAGCGAAATTTCTCGAGAAATTTCGCTTCTTTCGGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)