EMAIL THIS PAGE TO A FRIEND

HNRNPUL1

heterogeneous nuclear ribonucleoprotein U-like 1

205 Gene Product Result for
Synonyms: E1B-AP5 E1BAP5 HNRPUL1
Gene ID:
Human(11100) Summary: This gene encodes a nuclear RNA-binding protein of the heterogeneous nuclear ribonucleoprotein (hnRNP) family. This protein binds specifically to adenovirus E1B-55kDa oncoprotein. It may play an important role in nucleocytoplasmic RNA transport, and its function is modulated by E1B-55kDa in adenovirus-infected cells. Two transcript variants encoding different isoforms have been found for this gene. Additional variants have also been found, but their full-length natures have not been determined. [provided by RefSeq, Jul 2008]
Mouse(232989) heterogeneous nuclear ribonucleoprotein U-like 1
Rat(361522) heterogeneous nuclear ribonucleoprotein U-like 1
Zebrafish(406555) heterogeneous nuclear ribonucleoprotein U-like 1
domestic cat(101088706) heterogeneous nuclear ribonucleoprotein U-like 1
cow(533197) heterogeneous nuclear ribonucleoprotein U-like 1
Horse(100064935) heterogeneous nuclear ribonucleoprotein U-like 1
dog(476452) heterogeneous nuclear ribonucleoprotein U-like 1
chicken(776596) heterogeneous nuclear ribonucleoprotein U-like 1
sheep(101122300) heterogeneous nuclear ribonucleoprotein U-like 1
domestic guinea pig(100730237) heterogeneous nuclear ribonucleoprotein U-like 1
naked mole-rat(101701864) heterogeneous nuclear ribonucleoprotein U-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1408818 Anti-HNRNPUL1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
HPA046290 Anti-HNRNPUL1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
HPA049475 Anti-HNRNPUL1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB1410157 Anti-HNRNPUL1 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution mouse, human
immunofluorescence, western blot pricing
AV41129 Anti-HNRPUL1 (AB1) antibody produced in rabbit affinity isolated antibody human
western blot pricing
AV40702 Anti-HNRPUL1 (AB2) antibody produced in rabbit IgG fraction of antiserum horse, human, bovine, pig, dog
immunofluorescence, immunohistochemistry, immunoprecipitation (IP), western blot pricing
SAB2104673 Anti-HNRPUL1 antibody produced in rabbit affinity isolated antibody mouse, rat, human, guinea pig, rabbit, horse, dog
western blot pricing
SAB4200048 Monoclonal Anti-E1B-AP5 antibody produced in rat ~1.0 mg/mL, clone EAP4A11, purified immunoglobulin, buffered aqueous solution mouse, monkey, bovine, canine, human, rat
immunocytochemistry, immunoprecipitation (IP), western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144922 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144922 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144922 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_007040 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007040 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007040 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007040 Rosetta Predictions human pricing
NM_144732 Rosetta Predictions human pricing
NM_144733 Rosetta Predictions human pricing
NM_144734 Rosetta Predictions human pricing
NM_001108477 Rosetta Predictions rat pricing
NM_144922 Rosetta Predictions mouse pricing
NM_178089 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007040 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00342820 predicted 1539
2 SASI_Hs02_00342821 predicted 1784
3 SASI_Hs01_00240195 predicted 913
4 SASI_Hs01_00240196 predicted 1424
5 SASI_Hs01_00240199 predicted 1868
6 SASI_Hs01_00240200 predicted 1052
7 SASI_Hs02_00342822 predicted 1975
8 SASI_Hs02_00342823 predicted 1217
9 SASI_Hs02_00342824 predicted 1975
10 SASI_Hs02_00342825 predicted 1778
11 SASI_Hs01_00240192 predicted 2904
12 SASI_Hs01_00240193 predicted 2911
13 SASI_Hs01_00240194 predicted 2941
14 SASI_Hs01_00240197 predicted 2676
15 SASI_Hs01_00240198 predicted 2130
16 SASI_Hs01_00240201 predicted 2465
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144732 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00364692 predicted 1052
2 SASI_Hs02_00364693 predicted 1303
3 SASI_Hs01_00222854 predicted 426
4 SASI_Hs01_00222855 predicted 931
5 SASI_Hs01_00222858 predicted 1383
6 SASI_Hs01_00222859 predicted 562
7 SASI_Hs02_00364694 predicted 1483
8 SASI_Hs02_00364695 predicted 731
9 SASI_Hs02_00364696 predicted 1489
10 SASI_Hs02_00364697 predicted 1286
11 SASI_Hs01_00222851 predicted 2506
12 SASI_Hs01_00222852 predicted 2511
13 SASI_Hs01_00222853 predicted 2533
14 SASI_Hs01_00222856 predicted 2278
15 SASI_Hs01_00222857 predicted 1722
16 SASI_Hs01_00222860 predicted 2059
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144733 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00158314 predicted 2758
2 SASI_Hs01_00158315 predicted 2751
3 SASI_Hs01_00158316 predicted 2776
4 SASI_Hs01_00158317 predicted 805
5 SASI_Hs01_00158318 predicted 1316
6 SASI_Hs01_00158319 predicted 2522
7 SASI_Hs01_00158320 predicted 2130
8 SASI_Hs01_00158321 predicted 1757
9 SASI_Hs01_00158322 predicted 937
10 SASI_Hs01_00158323 predicted 2453
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144734 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00186145 predicted 842
2 SASI_Hs01_00186146 predicted 836
3 SASI_Hs01_00186147 predicted 863
4 SASI_Hs01_00186148 predicted 388
5 SASI_Hs01_00186149 predicted 919
6 SASI_Hs01_00186150 predicted 649
7 SASI_Hs01_00186151 predicted 606
8 SASI_Hs01_00186152 predicted 394
9 SASI_Hs01_00186153 predicted 539
10 SASI_Hs01_00186154 predicted 635
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108477 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00239029 predicted 497
2 SASI_Rn02_00239030 predicted 1664
3 SASI_Rn02_00239031 predicted 1257
4 SASI_Rn02_00239032 predicted 371
5 SASI_Rn02_00239033 predicted 1091
6 SASI_Rn02_00239034 predicted 996
7 SASI_Rn02_00239035 predicted 1227
8 SASI_Rn02_00239036 predicted 1959
9 SASI_Rn02_00239037 predicted 1770
10 SASI_Rn02_00239038 predicted 1768
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144922 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00090412 predicted 504
2 SASI_Mm01_00090413 predicted 574
3 SASI_Mm01_00090414 predicted 788
4 SASI_Mm01_00090416 predicted 576
5 SASI_Mm01_00090417 predicted 375
6 SASI_Mm01_00090418 predicted 443
7 SASI_Mm02_00340416 predicted 764
8 SASI_Mm01_00090419 predicted 719
9 SASI_Mm01_00090420 predicted 436
10 SASI_Mm01_00090421 predicted 451
11 SASI_Mm01_00090415 predicted 867
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178089 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00040622 predicted 478
2 SASI_Mm01_00040623 predicted 553
3 SASI_Mm01_00040624 predicted 770
4 SASI_Mm01_00040626 predicted 561
5 SASI_Mm01_00040627 predicted 354
6 SASI_Mm01_00040628 predicted 425
7 SASI_Mm02_00348571 predicted 749
8 SASI_Mm01_00040629 predicted 703
9 SASI_Mm01_00040630 predicted 422
10 SASI_Mm01_00040631 predicted 431
11 SASI_Mm01_00040625 predicted 822
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144922
VALIDATED
HNRNPUL1 MISSION shRNA Bacterial Glycerol Stock
heterogeneous nuclear ribonucleoprotein U-like 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000123481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144922.1-2465s1c1
Sequence:CCGGGCCTACAACTATGGGAGCTATCTCGAGATAGCTCCCATAGTTGTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144922.1-397s1c1
Sequence:CCGGCGGACATTATGTCATGGACAACTCGAGTTGTCCATGACATAATGTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144922.1-1598s1c1
Sequence:CCGGGCCCGAAAGAAGCGAAACTATCTCGAGATAGTTTCGCTTCTTTCGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144922.2-2516s21c1
Sequence:CCGGTACCCTCAGCCCAGCTATAACCTCGAGGTTATAGCTGGGCTGAGGGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144922.2-1543s21c1
Sequence:CCGGTCAGTGCCTCAACCGTCTTATCTCGAGATAAGACGGTTGAGGCACTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144922.2-1574s21c1
Sequence:CCGGGCCCGAAAGAAGCGAAACTATCTCGAGATAGTTTCGCTTCTTTCGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144922.1-1599s1c1
Sequence:CCGGCCCGAAAGAAGCGAAACTATACTCGAGTATAGTTTCGCTTCTTTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144922.2-2441s21c1
Sequence:CCGGGCCTACAACTATGGGAGCTATCTCGAGATAGCTCCCATAGTTGTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317907    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144922.2-2700s21c2
Sequence:CCGGGCTTCTAATAGCACCTGCCTTCTCGAGAAGGCAGGTGCTATTAGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144922
VALIDATED
HNRNPUL1 MISSION shRNA shRNA Plasmid DNA
heterogeneous nuclear ribonucleoprotein U-like 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000123481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144922.1-2465s1c1
Sequence:CCGGGCCTACAACTATGGGAGCTATCTCGAGATAGCTCCCATAGTTGTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144922.1-397s1c1
Sequence:CCGGCGGACATTATGTCATGGACAACTCGAGTTGTCCATGACATAATGTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144922.1-1598s1c1
Sequence:CCGGGCCCGAAAGAAGCGAAACTATCTCGAGATAGTTTCGCTTCTTTCGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144922.2-2516s21c1
Sequence:CCGGTACCCTCAGCCCAGCTATAACCTCGAGGTTATAGCTGGGCTGAGGGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144922.2-1543s21c1
Sequence:CCGGTCAGTGCCTCAACCGTCTTATCTCGAGATAAGACGGTTGAGGCACTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144922.2-1574s21c1
Sequence:CCGGGCCCGAAAGAAGCGAAACTATCTCGAGATAGTTTCGCTTCTTTCGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144922.1-1599s1c1
Sequence:CCGGCCCGAAAGAAGCGAAACTATACTCGAGTATAGTTTCGCTTCTTTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144922.2-2441s21c1
Sequence:CCGGGCCTACAACTATGGGAGCTATCTCGAGATAGCTCCCATAGTTGTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317907    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144922.2-2700s21c2
Sequence:CCGGGCTTCTAATAGCACCTGCCTTCTCGAGAAGGCAGGTGCTATTAGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144922
VALIDATED
HNRNPUL1 MISSION shRNA Lentiviral Transduction Particles
heterogeneous nuclear ribonucleoprotein U-like 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000123481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144922.1-2465s1c1
Sequence:CCGGGCCTACAACTATGGGAGCTATCTCGAGATAGCTCCCATAGTTGTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144922.1-397s1c1
Sequence:CCGGCGGACATTATGTCATGGACAACTCGAGTTGTCCATGACATAATGTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144922.1-1598s1c1
Sequence:CCGGGCCCGAAAGAAGCGAAACTATCTCGAGATAGTTTCGCTTCTTTCGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144922.2-2516s21c1
Sequence:CCGGTACCCTCAGCCCAGCTATAACCTCGAGGTTATAGCTGGGCTGAGGGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144922.2-1543s21c1
Sequence:CCGGTCAGTGCCTCAACCGTCTTATCTCGAGATAAGACGGTTGAGGCACTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144922.2-1574s21c1
Sequence:CCGGGCCCGAAAGAAGCGAAACTATCTCGAGATAGTTTCGCTTCTTTCGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144922.1-1599s1c1
Sequence:CCGGCCCGAAAGAAGCGAAACTATACTCGAGTATAGTTTCGCTTCTTTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144922.2-2441s21c1
Sequence:CCGGGCCTACAACTATGGGAGCTATCTCGAGATAGCTCCCATAGTTGTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317907    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144922.2-2700s21c2
Sequence:CCGGGCTTCTAATAGCACCTGCCTTCTCGAGAAGGCAGGTGCTATTAGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007040
VALIDATED
HNRNPUL1 MISSION shRNA Bacterial Glycerol Stock
heterogeneous nuclear ribonucleoprotein U-like 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000074729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_007040.2-1660s1c1
Sequence:CCGGCCCGCAAGAAACGCAACTATACTCGAGTATAGTTGCGTTTCTTGCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_007040.2-938s1c1
Sequence:CCGGCCGTGTATGCTTCGAGATGAACTCGAGTTCATCTCGAAGCATACACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_007040.2-1659s1c1
Sequence:CCGGGCCCGCAAGAAACGCAACTATCTCGAGATAGTTGCGTTTCTTGCGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_007040.2-2201s1c1
Sequence:CCGGCCGGGATAACAACAACTCCAACTCGAGTTGGAGTTGTTGTTATCCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074728    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_007040.2-3484s1c1
Sequence:CCGGGCTTCTGTGTTCAGTTGAATTCTCGAGAATTCAACTGAACACAGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344784    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_007040.3-3255s21c1
Sequence:CCGGCCTCATGCAGTTGGTTGTAAACTCGAGTTTACAACCAACTGCATGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_007040.3-2317s21c1
Sequence:CCGGCCGGGATAACAACAACTCCAACTCGAGTTGGAGTTGTTGTTATCCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_007040.3-1775s21c1
Sequence:CCGGGCCCGCAAGAAACGCAACTATCTCGAGATAGTTGCGTTTCTTGCGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_007040.3-1054s21c1
Sequence:CCGGCCGTGTATGCTTCGAGATGAACTCGAGTTCATCTCGAAGCATACACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007040
VALIDATED
HNRNPUL1 MISSION shRNA shRNA Plasmid DNA
heterogeneous nuclear ribonucleoprotein U-like 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000074729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_007040.2-1660s1c1
Sequence:CCGGCCCGCAAGAAACGCAACTATACTCGAGTATAGTTGCGTTTCTTGCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_007040.2-938s1c1
Sequence:CCGGCCGTGTATGCTTCGAGATGAACTCGAGTTCATCTCGAAGCATACACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_007040.2-1659s1c1
Sequence:CCGGGCCCGCAAGAAACGCAACTATCTCGAGATAGTTGCGTTTCTTGCGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_007040.2-2201s1c1
Sequence:CCGGCCGGGATAACAACAACTCCAACTCGAGTTGGAGTTGTTGTTATCCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074728    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_007040.2-3484s1c1
Sequence:CCGGGCTTCTGTGTTCAGTTGAATTCTCGAGAATTCAACTGAACACAGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344784    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_007040.3-3255s21c1
Sequence:CCGGCCTCATGCAGTTGGTTGTAAACTCGAGTTTACAACCAACTGCATGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_007040.3-2317s21c1
Sequence:CCGGCCGGGATAACAACAACTCCAACTCGAGTTGGAGTTGTTGTTATCCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_007040.3-1775s21c1
Sequence:CCGGGCCCGCAAGAAACGCAACTATCTCGAGATAGTTGCGTTTCTTGCGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_007040.3-1054s21c1
Sequence:CCGGCCGTGTATGCTTCGAGATGAACTCGAGTTCATCTCGAAGCATACACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007040
VALIDATED
HNRNPUL1 MISSION shRNA Lentiviral Transduction Particles
heterogeneous nuclear ribonucleoprotein U-like 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000074729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_007040.2-1660s1c1
Sequence:CCGGCCCGCAAGAAACGCAACTATACTCGAGTATAGTTGCGTTTCTTGCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_007040.2-938s1c1
Sequence:CCGGCCGTGTATGCTTCGAGATGAACTCGAGTTCATCTCGAAGCATACACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_007040.2-1659s1c1
Sequence:CCGGGCCCGCAAGAAACGCAACTATCTCGAGATAGTTGCGTTTCTTGCGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_007040.2-2201s1c1
Sequence:CCGGCCGGGATAACAACAACTCCAACTCGAGTTGGAGTTGTTGTTATCCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074728    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_007040.2-3484s1c1
Sequence:CCGGGCTTCTGTGTTCAGTTGAATTCTCGAGAATTCAACTGAACACAGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344784    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_007040.3-3255s21c1
Sequence:CCGGCCTCATGCAGTTGGTTGTAAACTCGAGTTTACAACCAACTGCATGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_007040.3-2317s21c1
Sequence:CCGGCCGGGATAACAACAACTCCAACTCGAGTTGGAGTTGTTGTTATCCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_007040.3-1775s21c1
Sequence:CCGGGCCCGCAAGAAACGCAACTATCTCGAGATAGTTGCGTTTCTTGCGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_007040.3-1054s21c1
Sequence:CCGGCCGTGTATGCTTCGAGATGAACTCGAGTTCATCTCGAAGCATACACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)