EMAIL THIS PAGE TO A FRIEND

HOGA1

4-hydroxy-2-oxoglutarate aldolase 1

96 Gene Product Result for
Synonyms: C10orf65 DHDPS2 DHDPSL HP3 NPL2
Gene ID:
Human(112817) Summary: The authors of PMID:20797690 cloned this gene while searching for genes in a region of chromosome 10 linked to primary hyperoxalurea type III. They noted that even though the encoded protein has been described as a mitochondrial dihydrodipicolinate synthase-like enzyme, it shares little homology with E. coli dihydrodipicolinate synthase (Dhdps), particularly in the putative substrate-binding region. Moreover, neither lysine biosynthesis nor sialic acid metabolism, for which Dhdps is responsible, occurs in vertebrate mitochondria. They propose that this gene encodes mitochondrial 4-hydroxyl-2-oxoglutarate aldolase (EC 4.1.3.16), which catalyzes the final step in the metabolic pathway of hydroxyproline, releasing glyoxylate and pyruvate. This gene is predominantly expressed in the liver and kidney, and mutations in this gene are found in patients with primary hyperoxalurea type III. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Nov 2010]
Mouse(67432) 4-hydroxy-2-oxoglutarate aldolase 1
Rat(293949) 4-hydroxy-2-oxoglutarate aldolase 1
Zebrafish(405806) 4-hydroxy-2-oxoglutarate aldolase 1
dog(608755) 4-hydroxy-2-oxoglutarate aldolase 1
Horse(100070689) 4-hydroxy-2-oxoglutarate aldolase 1
cow(506001) 4-hydroxy-2-oxoglutarate aldolase 1
domestic cat(101101417) 4-hydroxy-2-oxoglutarate aldolase 1
sheep(101114573) 4-hydroxy-2-oxoglutarate aldolase 1
domestic guinea pig(100720763) 4-hydroxy-2-oxoglutarate aldolase 1
naked mole-rat(101700602) 4-hydroxy-2-oxoglutarate aldolase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138413 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138413 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138413 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026152 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026152 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026152 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU133461 MISSION® esiRNA esiRNA human C10orf65 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138413 Rosetta Predictions human pricing
NM_001106355 Rosetta Predictions rat pricing
NM_026152 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138413 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00126975 predicted 825
2 SASI_Hs01_00126976 predicted 893
3 SASI_Hs01_00126977 predicted 945
4 SASI_Hs01_00126978 predicted 905
5 SASI_Hs01_00126979 predicted 570
6 SASI_Hs02_00363553 predicted 347
7 SASI_Hs01_00126980 predicted 1008
8 SASI_Hs01_00126981 predicted 648
9 SASI_Hs01_00126982 predicted 375
10 SASI_Hs01_00126983 predicted 1436
11 SASI_Hs01_00126984 predicted 963
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106355 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00218158 predicted 746
2 SASI_Rn02_00218159 predicted 913
3 SASI_Rn02_00218160 predicted 763
4 SASI_Rn02_00218161 predicted 1248
5 SASI_Rn02_00218162 predicted 660
6 SASI_Rn02_00218163 predicted 608
7 SASI_Rn02_00218164 predicted 881
8 SASI_Rn02_00218165 predicted 1420
9 SASI_Rn02_00218166 predicted 1418
10 SASI_Rn02_00218167 predicted 508
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026152 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00160218 predicted 1024
2 SASI_Mm01_00160219 predicted 1100
3 SASI_Mm01_00160220 predicted 526
4 SASI_Mm01_00160221 predicted 1150
5 SASI_Mm01_00160222 predicted 219
6 SASI_Mm01_00160223 predicted 593
7 SASI_Mm01_00160224 predicted 617
8 SASI_Mm01_00160225 predicted 922
9 SASI_Mm01_00160226 predicted 649
10 SASI_Mm01_00160227 predicted 516
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138413
HOGA1 MISSION shRNA Bacterial Glycerol Stock
4-hydroxy-2-oxoglutarate aldolase 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166741    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138413.2-910s1c1
Sequence:CCGGCCCGAATATTGTGGGCATGAACTCGAGTTCATGCCCACAATATTCGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165401    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138413.2-899s1c1
Sequence:CCGGCTTTCCCAGCACCCGAATATTCTCGAGAATATTCGGGTGCTGGGAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159264    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138413.2-2281s1c1
Sequence:CCGGGCTTGTCAGATTGGTAAATAACTCGAGTTATTTACCAATCTGACAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160456    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138413.2-2307s1c1
Sequence:CCGGCCTGGTGGATAAATGTTACATCTCGAGATGTAACATTTATCCACCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161117    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138413.2-1625s1c1
Sequence:CCGGGCACATGAAGTCAGAAAGGAACTCGAGTTCCTTTCTGACTTCATGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161877    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138413.2-964s1c1
Sequence:CCGGGATTGTTCACAAGACCAGGAACTCGAGTTCCTGGTCTTGTGAACAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162025    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138413.2-955s1c1
Sequence:CCGGGATTGGGCTGATTGTTCACAACTCGAGTTGTGAACAATCAGCCCAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165764    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138413.2-973s1c1
Sequence:CCGGCAAGACCAGGAAGCAGGATTTCTCGAGAAATCCTGCTTCCTGGTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166357    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138413.2-502s1c1
Sequence:CCGGCTATGGGAAACTGGAGGAGAACTCGAGTTCTCCTCCAGTTTCCCATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166506    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138413.2-574s1c1
Sequence:CCGGCAATGGCGAGTTTCCTTTCCTCTCGAGAGGAAAGGAAACTCGCCATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166616    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138413.2-512s1c1
Sequence:CCGGCTGGAGGAGAATCTGCACAAACTCGAGTTTGTGCAGATTCTCCTCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138413
HOGA1 MISSION shRNA shRNA Plasmid DNA
4-hydroxy-2-oxoglutarate aldolase 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166741    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138413.2-910s1c1
Sequence:CCGGCCCGAATATTGTGGGCATGAACTCGAGTTCATGCCCACAATATTCGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165401    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138413.2-899s1c1
Sequence:CCGGCTTTCCCAGCACCCGAATATTCTCGAGAATATTCGGGTGCTGGGAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159264    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138413.2-2281s1c1
Sequence:CCGGGCTTGTCAGATTGGTAAATAACTCGAGTTATTTACCAATCTGACAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160456    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138413.2-2307s1c1
Sequence:CCGGCCTGGTGGATAAATGTTACATCTCGAGATGTAACATTTATCCACCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161117    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138413.2-1625s1c1
Sequence:CCGGGCACATGAAGTCAGAAAGGAACTCGAGTTCCTTTCTGACTTCATGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161877    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138413.2-964s1c1
Sequence:CCGGGATTGTTCACAAGACCAGGAACTCGAGTTCCTGGTCTTGTGAACAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162025    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138413.2-955s1c1
Sequence:CCGGGATTGGGCTGATTGTTCACAACTCGAGTTGTGAACAATCAGCCCAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165764    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138413.2-973s1c1
Sequence:CCGGCAAGACCAGGAAGCAGGATTTCTCGAGAAATCCTGCTTCCTGGTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166357    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138413.2-502s1c1
Sequence:CCGGCTATGGGAAACTGGAGGAGAACTCGAGTTCTCCTCCAGTTTCCCATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166506    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138413.2-574s1c1
Sequence:CCGGCAATGGCGAGTTTCCTTTCCTCTCGAGAGGAAAGGAAACTCGCCATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166616    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138413.2-512s1c1
Sequence:CCGGCTGGAGGAGAATCTGCACAAACTCGAGTTTGTGCAGATTCTCCTCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138413
HOGA1 MISSION shRNA Lentiviral Transduction Particles
4-hydroxy-2-oxoglutarate aldolase 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166741    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138413.2-910s1c1
Sequence:CCGGCCCGAATATTGTGGGCATGAACTCGAGTTCATGCCCACAATATTCGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165401    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138413.2-899s1c1
Sequence:CCGGCTTTCCCAGCACCCGAATATTCTCGAGAATATTCGGGTGCTGGGAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159264    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138413.2-2281s1c1
Sequence:CCGGGCTTGTCAGATTGGTAAATAACTCGAGTTATTTACCAATCTGACAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160456    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138413.2-2307s1c1
Sequence:CCGGCCTGGTGGATAAATGTTACATCTCGAGATGTAACATTTATCCACCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161117    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138413.2-1625s1c1
Sequence:CCGGGCACATGAAGTCAGAAAGGAACTCGAGTTCCTTTCTGACTTCATGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161877    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138413.2-964s1c1
Sequence:CCGGGATTGTTCACAAGACCAGGAACTCGAGTTCCTGGTCTTGTGAACAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162025    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138413.2-955s1c1
Sequence:CCGGGATTGGGCTGATTGTTCACAACTCGAGTTGTGAACAATCAGCCCAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165764    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138413.2-973s1c1
Sequence:CCGGCAAGACCAGGAAGCAGGATTTCTCGAGAAATCCTGCTTCCTGGTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166357    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138413.2-502s1c1
Sequence:CCGGCTATGGGAAACTGGAGGAGAACTCGAGTTCTCCTCCAGTTTCCCATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166506    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138413.2-574s1c1
Sequence:CCGGCAATGGCGAGTTTCCTTTCCTCTCGAGAGGAAAGGAAACTCGCCATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166616    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138413.2-512s1c1
Sequence:CCGGCTGGAGGAGAATCTGCACAAACTCGAGTTTGTGCAGATTCTCCTCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026152
HOGA1 MISSION shRNA Bacterial Glycerol Stock
4-hydroxy-2-oxoglutarate aldolase 1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000120085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026152.1-613s1c1
Sequence:CCGGGCACCCAAATATCATCGGCTTCTCGAGAAGCCGATGATATTTGGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026152.1-1000s1c1
Sequence:CCGGGCGCTTGGATTTCAGCAACAACTCGAGTTGTTGCTGAAATCCAAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026152.1-197s1c1
Sequence:CCGGGCAGAGGTAGACTATGGGAAACTCGAGTTTCCCATAGTCTACCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026152.1-1001s1c1
Sequence:CCGGCGCTTGGATTTCAGCAACAATCTCGAGATTGTTGCTGAAATCCAAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026152
HOGA1 MISSION shRNA shRNA Plasmid DNA
4-hydroxy-2-oxoglutarate aldolase 1
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000120085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026152.1-613s1c1
Sequence:CCGGGCACCCAAATATCATCGGCTTCTCGAGAAGCCGATGATATTTGGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026152.1-1000s1c1
Sequence:CCGGGCGCTTGGATTTCAGCAACAACTCGAGTTGTTGCTGAAATCCAAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026152.1-197s1c1
Sequence:CCGGGCAGAGGTAGACTATGGGAAACTCGAGTTTCCCATAGTCTACCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026152.1-1001s1c1
Sequence:CCGGCGCTTGGATTTCAGCAACAATCTCGAGATTGTTGCTGAAATCCAAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026152
HOGA1 MISSION shRNA Lentiviral Transduction Particles
4-hydroxy-2-oxoglutarate aldolase 1
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000120085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026152.1-613s1c1
Sequence:CCGGGCACCCAAATATCATCGGCTTCTCGAGAAGCCGATGATATTTGGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026152.1-1000s1c1
Sequence:CCGGGCGCTTGGATTTCAGCAACAACTCGAGTTGTTGCTGAAATCCAAGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026152.1-197s1c1
Sequence:CCGGGCAGAGGTAGACTATGGGAAACTCGAGTTTCCCATAGTCTACCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026152.1-1001s1c1
Sequence:CCGGCGCTTGGATTTCAGCAACAATCTCGAGATTGTTGCTGAAATCCAAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)