EMAIL THIS PAGE TO A FRIEND

HOMER2

homer homolog 2 (Drosophila)

320 Gene Product Result for
Synonyms: ACPD CPD HOMER-2 VESL-2
UniProtKB ID: Q9NSB8, O95269, O95349, Q9NSB6, Q9NSB7, Q9UNT7
Gene ID:
Human(9455) Summary: This gene encodes a member of the homer family of dendritic proteins. Members of this family regulate group 1 metabotrophic glutamate receptor function. The encoded protein is a postsynaptic density scaffolding protein. Alternative splicing results in multiple transcript variants. Two related pseudogenes have been identified on chromosome 14. [provided by RefSeq, Jun 2011]
Mouse(26557) homer homolog 2 (Drosophila)
Rat(29547) homer homolog 2 (Drosophila)
Zebrafish(553661) homer homolog 2 (Drosophila)
chicken(415458) homer homolog 2 (Drosophila)
domestic cat(101097400) homer homolog 2 (Drosophila)
cow(510811) homer homolog 2 (Drosophila)
Horse(100068333) homer homolog 2 (Drosophila)
dog(479055) homer homolog 2 (Drosophila)
domestic guinea pig(100725053) homer homolog 2 (Drosophila)
naked mole-rat(101703383) homer homolog 2 (Drosophila)
sheep(101106114) homer homolog 2 (Drosophila)
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_199330 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_199330 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_199330 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011983 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011983 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011983 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004839 Rosetta Predictions human pricing
NM_199330 Rosetta Predictions human pricing
NM_199331 Rosetta Predictions human pricing
NM_199332 Rosetta Predictions human pricing
NM_053309 Rosetta Predictions rat pricing
NM_011983 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004839 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00095904 predicted 282
2 SASI_Hs01_00095905 predicted 1111
3 SASI_Hs01_00095908 predicted 1079
4 SASI_Hs02_00338415 predicted 1316
5 SASI_Hs01_00095909 predicted 1450
6 SASI_Hs01_00095911 predicted 1449
7 SASI_Hs01_00095912 predicted 275
8 SASI_Hs01_00095913 predicted 1256
9 SASI_Hs02_00338416 predicted 1147
10 SASI_Hs02_00338417 predicted 1423
11 SASI_Hs01_00095906 predicted 1483
12 SASI_Hs01_00095907 predicted 1197
13 SASI_Hs01_00095910 predicted 1474
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199330 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00243542 predicted 283
2 SASI_Hs01_00243543 predicted 1142
3 SASI_Hs01_00243546 predicted 1111
4 SASI_Hs02_00372746 predicted 1351
5 SASI_Hs01_00243547 predicted 1484
6 SASI_Hs01_00243549 predicted 1488
7 SASI_Hs01_00243550 predicted 276
8 SASI_Hs01_00243551 predicted 1284
9 SASI_Hs02_00372747 predicted 1182
10 SASI_Hs02_00372748 predicted 1460
11 SASI_Hs01_00243544 predicted 1517
12 SASI_Hs01_00243545 predicted 1232
13 SASI_Hs01_00243548 predicted 1508
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199331 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00078058 predicted 277
2 SASI_Hs01_00078059 predicted 948
3 SASI_Hs02_00372749 predicted 912
4 SASI_Hs02_00372750 predicted 1151
5 SASI_Hs02_00372751 predicted 1285
6 SASI_Hs02_00372752 predicted 1287
7 SASI_Hs02_00372753 predicted 284
8 SASI_Hs02_00372754 predicted 1087
9 SASI_Hs02_00372755 predicted 988
10 SASI_Hs02_00372756 predicted 1258
11 SASI_Hs01_00078060 predicted 316
12 SASI_Hs01_00078061 predicted 1035
13 SASI_Hs01_00078062 predicted 294
14 SASI_Hs01_00078063 predicted 283
15 SASI_Hs01_00078064 predicted 1104
16 SASI_Hs01_00078065 predicted 1119
17 SASI_Hs01_00078066 predicted 1122
18 SASI_Hs01_00078067 predicted 307
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199332 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00216157 predicted 283
2 SASI_Hs01_00216158 predicted 973
3 SASI_Hs02_00372757 predicted 950
4 SASI_Hs02_00372758 predicted 1182
5 SASI_Hs02_00372759 predicted 1316
6 SASI_Hs02_00372760 predicted 1325
7 SASI_Hs02_00372761 predicted 279
8 SASI_Hs02_00372762 predicted 1124
9 SASI_Hs02_00372763 predicted 1021
10 SASI_Hs02_00372764 predicted 1293
11 SASI_Hs01_00216159 predicted 316
12 SASI_Hs01_00216160 predicted 1069
13 SASI_Hs01_00216161 predicted 294
14 SASI_Hs01_00216162 predicted 279
15 SASI_Hs01_00216163 predicted 1135
16 SASI_Hs01_00216164 predicted 1155
17 SASI_Hs01_00216165 predicted 1150
18 SASI_Hs01_00216166 predicted 311
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053309 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00058208 predicted 451
2 SASI_Rn01_00058209 predicted 1078
3 SASI_Rn01_00058210 predicted 649
4 SASI_Rn01_00058211 predicted 1118
5 SASI_Rn02_00265718 predicted 1092
6 SASI_Rn01_00058212 predicted 566
7 SASI_Rn01_00058214 predicted 1025
8 SASI_Rn01_00058215 predicted 637
9 SASI_Rn01_00058216 predicted 908
10 SASI_Rn02_00265719 predicted 1353
11 SASI_Rn01_00058213 predicted 390
12 SASI_Rn01_00058217 predicted 722
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011983 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00117779 predicted 1360
2 SASI_Mm02_00321906 predicted 358
3 SASI_Mm01_00117780 predicted 917
4 SASI_Mm01_00117781 predicted 254
5 SASI_Mm01_00117782 predicted 1373
6 SASI_Mm01_00117783 predicted 995
7 SASI_Mm01_00117786 predicted 1104
8 SASI_Mm02_00321907 predicted 757
9 SASI_Mm02_00321908 predicted 971
10 SASI_Mm01_00117787 predicted 858
11 SASI_Mm01_00117784 predicted 848
12 SASI_Mm01_00117785 predicted 1329
13 SASI_Mm01_00117788 predicted 1173
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199330
HOMER2 MISSION shRNA Bacterial Glycerol Stock
homer homolog 2 (Drosophila)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000424616    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199330.1-1537s21c1
Sequence:CCGGTAAGGGCTGTTGCAACCATATCTCGAGATATGGTTGCAACAGCCCTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418116    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199330.1-1342s21c1
Sequence:CCGGTGTAAATGCAGGCGCAGTTTGCTCGAGCAAACTGCGCCTGCATTTACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199330.1-1090s1c1
Sequence:CCGGGAAGACAAAGTGCGTTCCTTACTCGAGTAAGGAACGCACTTTGTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199330.1-280s1c1
Sequence:CCGGGTCACCGTTTCCTACTTCTATCTCGAGATAGAAGTAGGAAACGGTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116132    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199330.1-1849s1c1
Sequence:CCGGCGGTTGCAACAGTGTTCCTTTCTCGAGAAAGGAACACTGTTGCAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199330.1-557s1c1
Sequence:CCGGCAAGTAATCATTCCCAAGAATCTCGAGATTCTTGGGAATGATTACTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199330.1-360s1c1
Sequence:CCGGCAGCACAATCACACCGAATATCTCGAGATATTCGGTGTGATTGTGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199330
HOMER2 MISSION shRNA shRNA Plasmid DNA
homer homolog 2 (Drosophila)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000424616    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199330.1-1537s21c1
Sequence:CCGGTAAGGGCTGTTGCAACCATATCTCGAGATATGGTTGCAACAGCCCTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418116    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199330.1-1342s21c1
Sequence:CCGGTGTAAATGCAGGCGCAGTTTGCTCGAGCAAACTGCGCCTGCATTTACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199330.1-1090s1c1
Sequence:CCGGGAAGACAAAGTGCGTTCCTTACTCGAGTAAGGAACGCACTTTGTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199330.1-280s1c1
Sequence:CCGGGTCACCGTTTCCTACTTCTATCTCGAGATAGAAGTAGGAAACGGTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116132    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199330.1-1849s1c1
Sequence:CCGGCGGTTGCAACAGTGTTCCTTTCTCGAGAAAGGAACACTGTTGCAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199330.1-557s1c1
Sequence:CCGGCAAGTAATCATTCCCAAGAATCTCGAGATTCTTGGGAATGATTACTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199330.1-360s1c1
Sequence:CCGGCAGCACAATCACACCGAATATCTCGAGATATTCGGTGTGATTGTGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199330
HOMER2 MISSION shRNA Lentiviral Transduction Particles
homer homolog 2 (Drosophila)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000424616    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199330.1-1537s21c1
Sequence:CCGGTAAGGGCTGTTGCAACCATATCTCGAGATATGGTTGCAACAGCCCTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418116    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199330.1-1342s21c1
Sequence:CCGGTGTAAATGCAGGCGCAGTTTGCTCGAGCAAACTGCGCCTGCATTTACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199330.1-1090s1c1
Sequence:CCGGGAAGACAAAGTGCGTTCCTTACTCGAGTAAGGAACGCACTTTGTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199330.1-280s1c1
Sequence:CCGGGTCACCGTTTCCTACTTCTATCTCGAGATAGAAGTAGGAAACGGTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116132    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199330.1-1849s1c1
Sequence:CCGGCGGTTGCAACAGTGTTCCTTTCTCGAGAAAGGAACACTGTTGCAACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199330.1-557s1c1
Sequence:CCGGCAAGTAATCATTCCCAAGAATCTCGAGATTCTTGGGAATGATTACTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199330.1-360s1c1
Sequence:CCGGCAGCACAATCACACCGAATATCTCGAGATATTCGGTGTGATTGTGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011983
VALIDATED
HOMER2 MISSION shRNA Bacterial Glycerol Stock
homer homolog 2 (Drosophila)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000316498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011983.1-160s21c1
Sequence:CCGGCGTCACGGTTTCCTACTTCTACTCGAGTAGAAGTAGGAAACCGTGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316500    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011983.1-1178s21c1
Sequence:CCGGCATTCTCCATTTGCTTCTGTACTCGAGTACAGAAGCAAATGGAGAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011983.1-982s21c1
Sequence:CCGGGCGGTCTCTAAAGACAGACATCTCGAGATGTCTGTCTTTAGAGACCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011983.1-253s21c1
Sequence:CCGGCCCGAACATGACTTTCACCAACTCGAGTTGGTGAAAGTCATGTTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011983.1-160s1c1
Sequence:CCGGCGTCACGGTTTCCTACTTCTACTCGAGTAGAAGTAGGAAACCGTGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011983.1-253s1c1
Sequence:CCGGCCCGAACATGACTTTCACCAACTCGAGTTGGTGAAAGTCATGTTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011983.1-982s1c1
Sequence:CCGGGCGGTCTCTAAAGACAGACATCTCGAGATGTCTGTCTTTAGAGACCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108510    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011983.1-1178s1c1
Sequence:CCGGCATTCTCCATTTGCTTCTGTACTCGAGTACAGAAGCAAATGGAGAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011983
VALIDATED
HOMER2 MISSION shRNA shRNA Plasmid DNA
homer homolog 2 (Drosophila)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000316498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011983.1-160s21c1
Sequence:CCGGCGTCACGGTTTCCTACTTCTACTCGAGTAGAAGTAGGAAACCGTGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316500    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011983.1-1178s21c1
Sequence:CCGGCATTCTCCATTTGCTTCTGTACTCGAGTACAGAAGCAAATGGAGAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011983.1-982s21c1
Sequence:CCGGGCGGTCTCTAAAGACAGACATCTCGAGATGTCTGTCTTTAGAGACCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011983.1-253s21c1
Sequence:CCGGCCCGAACATGACTTTCACCAACTCGAGTTGGTGAAAGTCATGTTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011983.1-160s1c1
Sequence:CCGGCGTCACGGTTTCCTACTTCTACTCGAGTAGAAGTAGGAAACCGTGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011983.1-253s1c1
Sequence:CCGGCCCGAACATGACTTTCACCAACTCGAGTTGGTGAAAGTCATGTTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011983.1-982s1c1
Sequence:CCGGGCGGTCTCTAAAGACAGACATCTCGAGATGTCTGTCTTTAGAGACCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108510    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011983.1-1178s1c1
Sequence:CCGGCATTCTCCATTTGCTTCTGTACTCGAGTACAGAAGCAAATGGAGAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011983
VALIDATED
HOMER2 MISSION shRNA Lentiviral Transduction Particles
homer homolog 2 (Drosophila)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000316498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011983.1-160s21c1
Sequence:CCGGCGTCACGGTTTCCTACTTCTACTCGAGTAGAAGTAGGAAACCGTGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316500    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011983.1-1178s21c1
Sequence:CCGGCATTCTCCATTTGCTTCTGTACTCGAGTACAGAAGCAAATGGAGAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011983.1-982s21c1
Sequence:CCGGGCGGTCTCTAAAGACAGACATCTCGAGATGTCTGTCTTTAGAGACCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011983.1-253s21c1
Sequence:CCGGCCCGAACATGACTTTCACCAACTCGAGTTGGTGAAAGTCATGTTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011983.1-160s1c1
Sequence:CCGGCGTCACGGTTTCCTACTTCTACTCGAGTAGAAGTAGGAAACCGTGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011983.1-253s1c1
Sequence:CCGGCCCGAACATGACTTTCACCAACTCGAGTTGGTGAAAGTCATGTTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011983.1-982s1c1
Sequence:CCGGGCGGTCTCTAAAGACAGACATCTCGAGATGTCTGTCTTTAGAGACCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108510    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011983.1-1178s1c1
Sequence:CCGGCATTCTCCATTTGCTTCTGTACTCGAGTACAGAAGCAAATGGAGAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)