EMAIL THIS PAGE TO A FRIEND

HOMER3

homer homolog 3 (Drosophila)

52 Gene Product Result for
Synonyms: HOMER-3 VESL3
Gene ID:
Human(9454) Summary: This gene encodes a member of the HOMER family of postsynaptic density scaffolding proteins that share a similar domain structure consisting of an N-terminal Enabled/vasodilator-stimulated phosphoprotein homology 1 domain which mediates protein-protein interactions, and a carboxy-terminal coiled-coil domain and two leucine zipper motifs that are involved in self-oligomerization. The encoded protein binds numerous other proteins including group I metabotropic glutamate receptors, inositol 1,4,5-trisphosphate receptors and amyloid precursor proteins and has been implicated in diverse biological functions such as neuronal signaling, T-cell activation and trafficking of amyloid beta peptides. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Mar 2009]
Mouse(26558) homer homolog 3 (Drosophila)
Rat(29548) homer homolog 3 (Drosophila)
Zebrafish(394088) homer homolog 3 (Drosophila)
domestic cat(101090173) homer homolog 3 (Drosophila)
cow(508124) homer homolog 3 (Drosophila)
dog(484813) homer homolog 3 (Drosophila)
chicken(420115) homer homolog 3 (Drosophila)
sheep(101106936) homer homolog 3 (Drosophila)
domestic guinea pig(100720595) homer homolog 3 (Drosophila)
naked mole-rat(101707378) homer homolog 3 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004838 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004838 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004838 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011984 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011984 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011984 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU037381 MISSION® esiRNA esiRNA targeting mouse Homer3 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004838 Rosetta Predictions human pricing
NM_053310 Rosetta Predictions rat pricing
NM_011984 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004838 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00132599 predicted 319
2 SASI_Hs02_00338413 predicted 678
3 SASI_Hs01_00132600 predicted 459
4 SASI_Hs02_00338414 predicted 480
5 SASI_Hs01_00132603 predicted 440
6 SASI_Hs01_00132604 predicted 382
7 SASI_Hs01_00132605 predicted 385
8 SASI_Hs01_00132606 predicted 450
9 SASI_Hs01_00132607 predicted 313
10 SASI_Hs01_00132608 predicted 425
11 SASI_Hs01_00132601 predicted 289
12 SASI_Hs01_00132602 predicted 964
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053310 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00088282 predicted 243
2 SASI_Rn01_00088283 predicted 388
3 SASI_Rn01_00088284 predicted 347
4 SASI_Rn01_00088285 predicted 315
5 SASI_Rn01_00088289 predicted 852
6 SASI_Rn01_00088290 predicted 270
7 SASI_Rn01_00088291 predicted 609
8 SASI_Rn02_00265720 predicted 487
9 SASI_Rn02_00265721 predicted 891
10 SASI_Rn02_00265722 predicted 407
11 SASI_Rn01_00088286 predicted 361
12 SASI_Rn01_00088287 predicted 860
13 SASI_Rn01_00088288 predicted 431
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011984 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00064868 predicted 1253
2 SASI_Mm01_00064869 predicted 211
3 SASI_Mm01_00064870 predicted 248
4 SASI_Mm01_00064871 predicted 901
5 SASI_Mm01_00064872 predicted 373
6 SASI_Mm01_00064873 predicted 1518
7 SASI_Mm01_00064874 predicted 368
8 SASI_Mm01_00064875 predicted 1181
9 SASI_Mm01_00064876 predicted 1469
10 SASI_Mm01_00064877 predicted 1277
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004838
VALIDATED
HOMER3 MISSION shRNA Bacterial Glycerol Stock
homer homolog 3 (Drosophila)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000447164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004838.3-816s21c1
Sequence:CCGGTTTCGCACTGCAGGACAGCAACTCGAGTTGCTGTCCTGCAGTGCGAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004838.2-477s1c1
Sequence:CCGGGAACAGCATCTGACACAGTTTCTCGAGAAACTGTGTCAGATGCTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004838.2-984s1c1
Sequence:CCGGCAAACCAAGGACCAGGAGATTCTCGAGAATCTCCTGGTCCTTGGTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000446700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004838.3-289s21c1
Sequence:CCGGGCGCACGTGTTCCAAATTGACCTCGAGGTCAATTTGGAACACGTGCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004838.2-364s1c1
Sequence:CCGGCCATCATCAACAGCACTGTCACTCGAGTGACAGTGCTGTTGATGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004838.2-701s1c1
Sequence:CCGGGCTAAAGAAGATGTTGTCTGACTCGAGTCAGACAACATCTTCTTTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004838.2-699s1c1
Sequence:CCGGCGGCTAAAGAAGATGTTGTCTCTCGAGAGACAACATCTTCTTTAGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004838
VALIDATED
HOMER3 MISSION shRNA shRNA Plasmid DNA
homer homolog 3 (Drosophila)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000447164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004838.3-816s21c1
Sequence:CCGGTTTCGCACTGCAGGACAGCAACTCGAGTTGCTGTCCTGCAGTGCGAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004838.2-477s1c1
Sequence:CCGGGAACAGCATCTGACACAGTTTCTCGAGAAACTGTGTCAGATGCTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004838.2-984s1c1
Sequence:CCGGCAAACCAAGGACCAGGAGATTCTCGAGAATCTCCTGGTCCTTGGTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000446700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004838.3-289s21c1
Sequence:CCGGGCGCACGTGTTCCAAATTGACCTCGAGGTCAATTTGGAACACGTGCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004838.2-364s1c1
Sequence:CCGGCCATCATCAACAGCACTGTCACTCGAGTGACAGTGCTGTTGATGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004838.2-701s1c1
Sequence:CCGGGCTAAAGAAGATGTTGTCTGACTCGAGTCAGACAACATCTTCTTTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004838.2-699s1c1
Sequence:CCGGCGGCTAAAGAAGATGTTGTCTCTCGAGAGACAACATCTTCTTTAGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004838
VALIDATED
HOMER3 MISSION shRNA Lentiviral Transduction Particles
homer homolog 3 (Drosophila)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000447164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004838.3-816s21c1
Sequence:CCGGTTTCGCACTGCAGGACAGCAACTCGAGTTGCTGTCCTGCAGTGCGAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004838.2-477s1c1
Sequence:CCGGGAACAGCATCTGACACAGTTTCTCGAGAAACTGTGTCAGATGCTGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004838.2-984s1c1
Sequence:CCGGCAAACCAAGGACCAGGAGATTCTCGAGAATCTCCTGGTCCTTGGTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000446700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004838.3-289s21c1
Sequence:CCGGGCGCACGTGTTCCAAATTGACCTCGAGGTCAATTTGGAACACGTGCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004838.2-364s1c1
Sequence:CCGGCCATCATCAACAGCACTGTCACTCGAGTGACAGTGCTGTTGATGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004838.2-701s1c1
Sequence:CCGGGCTAAAGAAGATGTTGTCTGACTCGAGTCAGACAACATCTTCTTTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004838.2-699s1c1
Sequence:CCGGCGGCTAAAGAAGATGTTGTCTCTCGAGAGACAACATCTTCTTTAGCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011984
VALIDATED
HOMER3 MISSION shRNA Bacterial Glycerol Stock
homer homolog 3 (Drosophila)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000305230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011984.2-389s21c1
Sequence:CCGGCTCTCAGAAGTTCGGGCAATGCTCGAGCATTGCCCGAACTTCTGAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011984.2-957s21c1
Sequence:CCGGCAGACCAAGGACCAGACTTTGCTCGAGCAAAGTCTGGTCCTTGGTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011984.2-469s21c1
Sequence:CCGGCCCAGTTTGCTGAGAAGTTTCCTCGAGGAAACTTCTCAGCAAACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011984.2-516s21c2
Sequence:CCGGGCTCGAGAGAAATCTCAAGATCTCGAGATCTTGAGATTTCTCTCGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011984.2-266s21c1
Sequence:CCGGGCACGCACTTACCGTGTCCTACTCGAGTAGGACACGGTAAGTGCGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011984.1-465s1c1
Sequence:CCGGGCTCGAGAGAAATCTCAAGATCTCGAGATCTTGAGATTTCTCTCGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106550    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011984.1-1877s1c1
Sequence:CCGGCGCTTGTTGATCTCTTTCTTTCTCGAGAAAGAAAGAGATCAACAAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011984.1-747s1c1
Sequence:CCGGGCCACTCAGTGGAGGCAACAACTCGAGTTGTTGCCTCCACTGAGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011984.1-215s1c1
Sequence:CCGGGCACGCACTTACCGTGTCCTACTCGAGTAGGACACGGTAAGTGCGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011984.1-251s1c1
Sequence:CCGGCCGAAATGTGTACCGCATCATCTCGAGATGATGCGGTACACATTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011984
VALIDATED
HOMER3 MISSION shRNA shRNA Plasmid DNA
homer homolog 3 (Drosophila)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000305230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011984.2-389s21c1
Sequence:CCGGCTCTCAGAAGTTCGGGCAATGCTCGAGCATTGCCCGAACTTCTGAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011984.2-957s21c1
Sequence:CCGGCAGACCAAGGACCAGACTTTGCTCGAGCAAAGTCTGGTCCTTGGTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011984.2-469s21c1
Sequence:CCGGCCCAGTTTGCTGAGAAGTTTCCTCGAGGAAACTTCTCAGCAAACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011984.2-516s21c2
Sequence:CCGGGCTCGAGAGAAATCTCAAGATCTCGAGATCTTGAGATTTCTCTCGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000351209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011984.2-266s21c1
Sequence:CCGGGCACGCACTTACCGTGTCCTACTCGAGTAGGACACGGTAAGTGCGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011984.1-465s1c1
Sequence:CCGGGCTCGAGAGAAATCTCAAGATCTCGAGATCTTGAGATTTCTCTCGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106550    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011984.1-1877s1c1
Sequence:CCGGCGCTTGTTGATCTCTTTCTTTCTCGAGAAAGAAAGAGATCAACAAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011984.1-747s1c1
Sequence:CCGGGCCACTCAGTGGAGGCAACAACTCGAGTTGTTGCCTCCACTGAGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011984.1-215s1c1
Sequence:CCGGGCACGCACTTACCGTGTCCTACTCGAGTAGGACACGGTAAGTGCGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011984.1-251s1c1
Sequence:CCGGCCGAAATGTGTACCGCATCATCTCGAGATGATGCGGTACACATTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011984
VALIDATED
HOMER3 MISSION shRNA Lentiviral Transduction Particles
homer homolog 3 (Drosophila)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000305230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011984.2-389s21c1
Sequence:CCGGCTCTCAGAAGTTCGGGCAATGCTCGAGCATTGCCCGAACTTCTGAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011984.2-957s21c1
Sequence:CCGGCAGACCAAGGACCAGACTTTGCTCGAGCAAAGTCTGGTCCTTGGTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011984.2-469s21c1
Sequence:CCGGCCCAGTTTGCTGAGAAGTTTCCTCGAGGAAACTTCTCAGCAAACTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011984.2-516s21c2
Sequence:CCGGGCTCGAGAGAAATCTCAAGATCTCGAGATCTTGAGATTTCTCTCGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011984.2-266s21c1
Sequence:CCGGGCACGCACTTACCGTGTCCTACTCGAGTAGGACACGGTAAGTGCGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011984.1-465s1c1
Sequence:CCGGGCTCGAGAGAAATCTCAAGATCTCGAGATCTTGAGATTTCTCTCGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106550    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011984.1-1877s1c1
Sequence:CCGGCGCTTGTTGATCTCTTTCTTTCTCGAGAAAGAAAGAGATCAACAAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011984.1-747s1c1
Sequence:CCGGGCCACTCAGTGGAGGCAACAACTCGAGTTGTTGCCTCCACTGAGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011984.1-215s1c1
Sequence:CCGGGCACGCACTTACCGTGTCCTACTCGAGTAGGACACGGTAAGTGCGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011984.1-251s1c1
Sequence:CCGGCCGAAATGTGTACCGCATCATCTCGAGATGATGCGGTACACATTTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)