EMAIL THIS PAGE TO A FRIEND

HOMEZ

homeobox and leucine zipper encoding

136 Gene Product Result for
Synonyms: KIAA1443
UniProtKB ID: Q8IX15, A1L445, Q6P049, Q86XB6, Q9P2A5
Gene ID:
Mouse(239099) homeodomain leucine zipper-encoding gene
Rat(260325) homeobox and leucine zipper encoding
domestic guinea pig(100717206) homeobox and leucine zipper encoding
naked mole-rat(101716922) homeobox and leucine zipper encoding
sheep(101121520) homeobox and leucine zipper encoding
Domestic Rabbit(100339263) homeobox and leucine zipper encoding
Zebrafish(368671) homeodomain leucine zipper gene
cow(614181) homeobox and leucine zipper encoding
Horse(100055733) homeobox and leucine zipper encoding
dog(100688484) homeobox and leucine zipper encoding
domestic cat(101094678) homeobox and leucine zipper encoding
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_183174 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_183174 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_183174 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020834 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020834 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020834 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU222131 MISSION® esiRNA esiRNA targeting human HOMEZ human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020834 Rosetta Predictions human pricing
NM_152849 Rosetta Predictions rat pricing
NM_183174 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020834 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00015907 predicted 658
2 SASI_Hs01_00015909 predicted 861
3 SASI_Hs01_00015911 predicted 931
4 SASI_Hs01_00015912 predicted 911
5 SASI_Hs01_00015913 predicted 621
6 SASI_Hs01_00015914 predicted 940
7 SASI_Hs01_00015915 predicted 1031
8 SASI_Hs01_00015916 predicted 376
9 SASI_Hs02_00354074 predicted 534
10 SASI_Hs02_00354075 predicted 2027
11 SASI_Hs01_00015908 predicted 2142
12 SASI_Hs01_00015910 predicted 364
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152849 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00069943 predicted 1195
2 SASI_Rn01_00069944 predicted 1174
3 SASI_Rn01_00069945 predicted 665
4 SASI_Rn02_00268914 predicted 349
5 SASI_Rn01_00069946 predicted 773
6 SASI_Rn01_00069947 predicted 985
7 SASI_Rn01_00069948 predicted 627
8 SASI_Rn02_00268915 predicted 1257
9 SASI_Rn02_00268916 predicted 776
10 SASI_Rn02_00268917 predicted 1167
11 SASI_Rn01_00069949 predicted 650
12 SASI_Rn01_00069950 predicted 917
13 SASI_Rn01_00069951 predicted 916
14 SASI_Rn01_00069952 predicted 357
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183174 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00043503 predicted 678
2 SASI_Mm01_00043504 predicted 1004
3 SASI_Mm02_00350271 predicted 1308
4 SASI_Mm01_00043505 predicted 776
5 SASI_Mm01_00043507 predicted 836
6 SASI_Mm01_00043508 predicted 796
7 SASI_Mm01_00043509 predicted 1176
8 SASI_Mm02_00350272 predicted 252
9 SASI_Mm02_00350273 predicted 213
10 SASI_Mm01_00043510 predicted 655
11 SASI_Mm01_00043501 predicted 1246
12 SASI_Mm01_00043502 predicted 356
13 SASI_Mm01_00043506 predicted 1156
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183174
HOMEZ MISSION shRNA Bacterial Glycerol Stock
homeobox and leucine zipper encoding
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000423246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183174.2-945s21c1
Sequence:CCGGCAGTCACTCTCACCTAGTAAGCTCGAGCTTACTAGGTGAGAGTGACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183174.1-1300s1c1
Sequence:CCGGCCGGAGATCATTCAATGGTTTCTCGAGAAACCATTGAATGATCTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183174.1-749s1c1
Sequence:CCGGGCAGAACATTCTCCCACCAATCTCGAGATTGGTGGGAGAATGTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183174.1-1479s1c1
Sequence:CCGGCCCACCAGATATACGACCTTTCTCGAGAAAGGTCGTATATCTGGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183174.1-277s1c1
Sequence:CCGGCTACAGCTTGTGTGGACTCAACTCGAGTTGAGTCCACACAAGCTGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183174.1-899s1c1
Sequence:CCGGCGGTCTCATTACTTGATAATACTCGAGTATTATCAAGTAATGAGACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183174
HOMEZ MISSION shRNA shRNA Plasmid DNA
homeobox and leucine zipper encoding
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000423246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183174.2-945s21c1
Sequence:CCGGCAGTCACTCTCACCTAGTAAGCTCGAGCTTACTAGGTGAGAGTGACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183174.1-1300s1c1
Sequence:CCGGCCGGAGATCATTCAATGGTTTCTCGAGAAACCATTGAATGATCTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183174.1-749s1c1
Sequence:CCGGGCAGAACATTCTCCCACCAATCTCGAGATTGGTGGGAGAATGTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183174.1-1479s1c1
Sequence:CCGGCCCACCAGATATACGACCTTTCTCGAGAAAGGTCGTATATCTGGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183174.1-277s1c1
Sequence:CCGGCTACAGCTTGTGTGGACTCAACTCGAGTTGAGTCCACACAAGCTGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183174.1-899s1c1
Sequence:CCGGCGGTCTCATTACTTGATAATACTCGAGTATTATCAAGTAATGAGACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183174
HOMEZ MISSION shRNA Lentiviral Transduction Particles
homeobox and leucine zipper encoding
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000423246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183174.2-945s21c1
Sequence:CCGGCAGTCACTCTCACCTAGTAAGCTCGAGCTTACTAGGTGAGAGTGACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183174.1-1300s1c1
Sequence:CCGGCCGGAGATCATTCAATGGTTTCTCGAGAAACCATTGAATGATCTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183174.1-749s1c1
Sequence:CCGGGCAGAACATTCTCCCACCAATCTCGAGATTGGTGGGAGAATGTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183174.1-1479s1c1
Sequence:CCGGCCCACCAGATATACGACCTTTCTCGAGAAAGGTCGTATATCTGGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183174.1-277s1c1
Sequence:CCGGCTACAGCTTGTGTGGACTCAACTCGAGTTGAGTCCACACAAGCTGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183174.1-899s1c1
Sequence:CCGGCGGTCTCATTACTTGATAATACTCGAGTATTATCAAGTAATGAGACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020834
VALIDATED
HOMEZ MISSION shRNA Bacterial Glycerol Stock
homeobox and leucine zipper encoding
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000244453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_020834.2-1378s21c1
Sequence:CCGGCTTGAAGCATGGGCAACTAAACTCGAGTTTAGTTGCCCATGCTTCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_020834.2-914s21c1
Sequence:CCGGCAGCCACAAGCTCGGGATAAACTCGAGTTTATCCCGAGCTTGTGGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244455    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020834.2-3058s21c1
Sequence:CCGGCAGCTTGACAGAGACTAATTTCTCGAGAAATTAGTCTCTGTCAAGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_020834.2-214s21c1
Sequence:CCGGAGGCACCATGCCTCCTAATAACTCGAGTTATTAGGAGGCATGGTGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_020834.2-1332s21c1
Sequence:CCGGTACCTCGGCCTGAGATCATTCCTCGAGGAATGATCTCAGGCCGAGGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020834.1-1591s1c1
Sequence:CCGGGCTGAGGTGGTAGTTTGTCTACTCGAGTAGACAAACTACCACCTCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020834.1-1264s1c1
Sequence:CCGGCCTGAGATCATTCAGTGGTTTCTCGAGAAACCACTGAATGATCTCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020834.1-339s1c1
Sequence:CCGGCCTACGTTATGGGTTGCAGATCTCGAGATCTGCAACCCATAACGTAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020834.1-1561s1c1
Sequence:CCGGGATTGGTTTGACTCTCGATTACTCGAGTAATCGAGAGTCAAACCAATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020834.1-460s1c1
Sequence:CCGGCGGGACCAACTCCATTTCAAACTCGAGTTTGAAATGGAGTTGGTCCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020834
VALIDATED
HOMEZ MISSION shRNA shRNA Plasmid DNA
homeobox and leucine zipper encoding
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000244453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_020834.2-1378s21c1
Sequence:CCGGCTTGAAGCATGGGCAACTAAACTCGAGTTTAGTTGCCCATGCTTCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_020834.2-914s21c1
Sequence:CCGGCAGCCACAAGCTCGGGATAAACTCGAGTTTATCCCGAGCTTGTGGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244455    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020834.2-3058s21c1
Sequence:CCGGCAGCTTGACAGAGACTAATTTCTCGAGAAATTAGTCTCTGTCAAGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_020834.2-214s21c1
Sequence:CCGGAGGCACCATGCCTCCTAATAACTCGAGTTATTAGGAGGCATGGTGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_020834.2-1332s21c1
Sequence:CCGGTACCTCGGCCTGAGATCATTCCTCGAGGAATGATCTCAGGCCGAGGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020834.1-1591s1c1
Sequence:CCGGGCTGAGGTGGTAGTTTGTCTACTCGAGTAGACAAACTACCACCTCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020834.1-1264s1c1
Sequence:CCGGCCTGAGATCATTCAGTGGTTTCTCGAGAAACCACTGAATGATCTCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020834.1-339s1c1
Sequence:CCGGCCTACGTTATGGGTTGCAGATCTCGAGATCTGCAACCCATAACGTAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020834.1-1561s1c1
Sequence:CCGGGATTGGTTTGACTCTCGATTACTCGAGTAATCGAGAGTCAAACCAATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020834.1-460s1c1
Sequence:CCGGCGGGACCAACTCCATTTCAAACTCGAGTTTGAAATGGAGTTGGTCCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020834
VALIDATED
HOMEZ MISSION shRNA Lentiviral Transduction Particles
homeobox and leucine zipper encoding
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000244453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_020834.2-1378s21c1
Sequence:CCGGCTTGAAGCATGGGCAACTAAACTCGAGTTTAGTTGCCCATGCTTCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_020834.2-914s21c1
Sequence:CCGGCAGCCACAAGCTCGGGATAAACTCGAGTTTATCCCGAGCTTGTGGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244455    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020834.2-3058s21c1
Sequence:CCGGCAGCTTGACAGAGACTAATTTCTCGAGAAATTAGTCTCTGTCAAGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_020834.2-214s21c1
Sequence:CCGGAGGCACCATGCCTCCTAATAACTCGAGTTATTAGGAGGCATGGTGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_020834.2-1332s21c1
Sequence:CCGGTACCTCGGCCTGAGATCATTCCTCGAGGAATGATCTCAGGCCGAGGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020834.1-1591s1c1
Sequence:CCGGGCTGAGGTGGTAGTTTGTCTACTCGAGTAGACAAACTACCACCTCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020834.1-1264s1c1
Sequence:CCGGCCTGAGATCATTCAGTGGTTTCTCGAGAAACCACTGAATGATCTCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020834.1-339s1c1
Sequence:CCGGCCTACGTTATGGGTTGCAGATCTCGAGATCTGCAACCCATAACGTAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020834.1-1561s1c1
Sequence:CCGGGATTGGTTTGACTCTCGATTACTCGAGTAATCGAGAGTCAAACCAATCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020834.1-460s1c1
Sequence:CCGGCGGGACCAACTCCATTTCAAACTCGAGTTTGAAATGGAGTTGGTCCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)