EMAIL THIS PAGE TO A FRIEND

HOOK1

hook microtubule-tethering protein 1

209 Gene Product Result for
Synonyms: HK1
UniProtKB ID: Q9UJC3, A8K8E9, O60561, Q5TG44
Gene ID:
Human(51361) Summary: This gene encodes a member of the hook family of coiled-coil proteins, which bind to microtubules and organelles through their N- and C-terminal domains, respectively. The encoded protein localizes to discrete punctuate subcellular structures, and interacts with several members of the Rab GTPase family involved in endocytosis. It is thought to link endocytic membrane trafficking to the microtubule cytoskeleton. Several alternatively spliced transcript variants have been identified, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Jul 2008]
Mouse(77963) hook homolog 1 (Drosophila)
Rat(313370) hook homolog 1 (Drosophila)
Zebrafish(570393) hook homolog 1
chicken(424675) hook homolog 1 (Drosophila)
dog(479553) hook homolog 1 (Drosophila)
domestic cat(101097502) hook homolog 1 (Drosophila)
Horse(100067325) hook homolog 1 (Drosophila)
sheep(101104698) hook homolog 1 (Drosophila)
Domestic Rabbit(100358176) hook homolog 1 (Drosophila)
domestic guinea pig(100727644) hook homolog 1 (Drosophila)
naked mole-rat(101707830) hook homolog 1 (Drosophila)
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015888 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015888 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015888 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_030014 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030014 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030014 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015888 Rosetta Predictions human pricing
NM_001107946 Rosetta Predictions rat pricing
NM_030014 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015888 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00225935 predicted 553
2 SASI_Hs01_00225938 predicted 1212
3 SASI_Hs01_00225939 predicted 418
4 SASI_Hs01_00225941 predicted 1344
5 SASI_Hs01_00225942 predicted 1397
6 SASI_Hs02_00348471 predicted 1854
7 SASI_Hs01_00225943 predicted 498
8 SASI_Hs01_00225944 predicted 1217
9 SASI_Hs02_00348472 predicted 1437
10 SASI_Hs02_00348473 predicted 709
11 SASI_Hs01_00225936 predicted 1877
12 SASI_Hs01_00225937 predicted 1109
13 SASI_Hs01_00225940 predicted 783
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107946 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00233845 predicted 2485
2 SASI_Rn02_00233846 predicted 426
3 SASI_Rn02_00233847 predicted 490
4 SASI_Rn02_00233848 predicted 706
5 SASI_Rn02_00233849 predicted 1370
6 SASI_Rn02_00233850 predicted 1206
7 SASI_Rn02_00233851 predicted 1869
8 SASI_Rn02_00233852 predicted 357
9 SASI_Rn02_00233853 predicted 2004
10 SASI_Rn02_00233854 predicted 749
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030014 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00336376 predicted 282
2 SASI_Mm01_00154090 predicted 295
3 SASI_Mm01_00154091 predicted 263
4 SASI_Mm01_00154092 predicted 2377
5 SASI_Mm01_00154093 predicted 2256
6 SASI_Mm01_00154094 predicted 950
7 SASI_Mm01_00154095 predicted 1421
8 SASI_Mm01_00154096 predicted 1069
9 SASI_Mm01_00154097 predicted 2042
10 SASI_Mm01_00154098 predicted 1213
11 SASI_Mm01_00154099 predicted 1161
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015888
HOOK1 MISSION shRNA Bacterial Glycerol Stock
hook microtubule-tethering protein 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000157608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015888.3-1442s1c1
Sequence:CCGGGCGTTTGAAATGAAGCGGCTTCTCGAGAAGCCGCTTCATTTCAAACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153925    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015888.3-2120s1c1
Sequence:CCGGCCCAAGTTAAATCCAGCATCACTCGAGTGATGCTGGATTTAACTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015888.3-424s1c1
Sequence:CCGGCGAATCTTGGTTAAGCCGAATCTCGAGATTCGGCTTAACCAAGATTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015888.3-551s1c1
Sequence:CCGGGAAGCACTTATCCCTGATTTACTCGAGTAAATCAGGGATAAGTGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151187    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015888.3-2135s1c1
Sequence:CCGGGCATCAGCTGAAATAATGCTACTCGAGTAGCATTATTTCAGCTGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015888.3-1187s1c1
Sequence:CCGGGCTACCTCTGATAAAGCAAATCTCGAGATTTGCTTTATCAGAGGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152625    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015888.3-1543s1c1
Sequence:CCGGGCTTCGATGTTCACAAGTACACTCGAGTGTACTTGTGAACATCGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015888.3-1741s1c1
Sequence:CCGGGCTAGAACAGAAACACCGTAACTCGAGTTACGGTGTTTCTGTTCTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219939    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015888.4-3189s1c1
Sequence:CCGGTGATGGAAAGCAAGCTATATACTCGAGTATATAGCTTGCTTTCCATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015888
HOOK1 MISSION shRNA shRNA Plasmid DNA
hook microtubule-tethering protein 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000157608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015888.3-1442s1c1
Sequence:CCGGGCGTTTGAAATGAAGCGGCTTCTCGAGAAGCCGCTTCATTTCAAACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153925    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015888.3-2120s1c1
Sequence:CCGGCCCAAGTTAAATCCAGCATCACTCGAGTGATGCTGGATTTAACTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015888.3-424s1c1
Sequence:CCGGCGAATCTTGGTTAAGCCGAATCTCGAGATTCGGCTTAACCAAGATTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015888.3-551s1c1
Sequence:CCGGGAAGCACTTATCCCTGATTTACTCGAGTAAATCAGGGATAAGTGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151187    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015888.3-2135s1c1
Sequence:CCGGGCATCAGCTGAAATAATGCTACTCGAGTAGCATTATTTCAGCTGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015888.3-1187s1c1
Sequence:CCGGGCTACCTCTGATAAAGCAAATCTCGAGATTTGCTTTATCAGAGGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152625    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015888.3-1543s1c1
Sequence:CCGGGCTTCGATGTTCACAAGTACACTCGAGTGTACTTGTGAACATCGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015888.3-1741s1c1
Sequence:CCGGGCTAGAACAGAAACACCGTAACTCGAGTTACGGTGTTTCTGTTCTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219939    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015888.4-3189s1c1
Sequence:CCGGTGATGGAAAGCAAGCTATATACTCGAGTATATAGCTTGCTTTCCATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015888
HOOK1 MISSION shRNA Lentiviral Transduction Particles
hook microtubule-tethering protein 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000157608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015888.3-1442s1c1
Sequence:CCGGGCGTTTGAAATGAAGCGGCTTCTCGAGAAGCCGCTTCATTTCAAACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153925    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015888.3-2120s1c1
Sequence:CCGGCCCAAGTTAAATCCAGCATCACTCGAGTGATGCTGGATTTAACTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015888.3-424s1c1
Sequence:CCGGCGAATCTTGGTTAAGCCGAATCTCGAGATTCGGCTTAACCAAGATTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015888.3-551s1c1
Sequence:CCGGGAAGCACTTATCCCTGATTTACTCGAGTAAATCAGGGATAAGTGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151187    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015888.3-2135s1c1
Sequence:CCGGGCATCAGCTGAAATAATGCTACTCGAGTAGCATTATTTCAGCTGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015888.3-1187s1c1
Sequence:CCGGGCTACCTCTGATAAAGCAAATCTCGAGATTTGCTTTATCAGAGGTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152625    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015888.3-1543s1c1
Sequence:CCGGGCTTCGATGTTCACAAGTACACTCGAGTGTACTTGTGAACATCGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015888.3-1741s1c1
Sequence:CCGGGCTAGAACAGAAACACCGTAACTCGAGTTACGGTGTTTCTGTTCTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219939    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015888.4-3189s1c1
Sequence:CCGGTGATGGAAAGCAAGCTATATACTCGAGTATATAGCTTGCTTTCCATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030014
HOOK1 MISSION shRNA Bacterial Glycerol Stock
hook microtubule-tethering protein 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000111530    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030014.2-3717s1c1
Sequence:CCGGCCCAGAACATTGCCAGTCATTCTCGAGAATGACTGGCAATGTTCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030014.2-283s1c1
Sequence:CCGGCGAATCTTGGTTAAGCCGAATCTCGAGATTCGGCTTAACCAAGATTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030014.2-1135s1c1
Sequence:CCGGGAAATCTTTACAGGAGACAAACTCGAGTTTGTCTCCTGTAAAGATTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030014.2-2062s1c1
Sequence:CCGGGAGTGAATGTAAAGTAGCAAACTCGAGTTTGCTACTTTACATTCACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030014.2-1046s1c1
Sequence:CCGGGCTACGTCAGACAAAGCAAATCTCGAGATTTGCTTTGTCTGACGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030014
HOOK1 MISSION shRNA shRNA Plasmid DNA
hook microtubule-tethering protein 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000111530    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030014.2-3717s1c1
Sequence:CCGGCCCAGAACATTGCCAGTCATTCTCGAGAATGACTGGCAATGTTCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030014.2-283s1c1
Sequence:CCGGCGAATCTTGGTTAAGCCGAATCTCGAGATTCGGCTTAACCAAGATTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030014.2-1135s1c1
Sequence:CCGGGAAATCTTTACAGGAGACAAACTCGAGTTTGTCTCCTGTAAAGATTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030014.2-2062s1c1
Sequence:CCGGGAGTGAATGTAAAGTAGCAAACTCGAGTTTGCTACTTTACATTCACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030014.2-1046s1c1
Sequence:CCGGGCTACGTCAGACAAAGCAAATCTCGAGATTTGCTTTGTCTGACGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030014
HOOK1 MISSION shRNA Lentiviral Transduction Particles
hook microtubule-tethering protein 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000111530    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030014.2-3717s1c1
Sequence:CCGGCCCAGAACATTGCCAGTCATTCTCGAGAATGACTGGCAATGTTCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030014.2-283s1c1
Sequence:CCGGCGAATCTTGGTTAAGCCGAATCTCGAGATTCGGCTTAACCAAGATTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030014.2-1135s1c1
Sequence:CCGGGAAATCTTTACAGGAGACAAACTCGAGTTTGTCTCCTGTAAAGATTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030014.2-2062s1c1
Sequence:CCGGGAGTGAATGTAAAGTAGCAAACTCGAGTTTGCTACTTTACATTCACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030014.2-1046s1c1
Sequence:CCGGGCTACGTCAGACAAAGCAAATCTCGAGATTTGCTTTGTCTGACGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)