EMAIL THIS PAGE TO A FRIEND

HOOK2

hook microtubule-tethering protein 2

125 Gene Product Result for
Synonyms: HK2
UniProtKB ID: Q96ED9, O60562
Gene ID:
Human(29911) Summary: Hook proteins are cytosolic coiled-coil proteins that contain conserved N-terminal domains, which attach to microtubules, and more divergent C-terminal domains, which mediate binding to organelles. The Drosophila Hook protein is a component of the endocytic compartment.[supplied by OMIM, Apr 2004]
Mouse(170833) hook homolog 2 (Drosophila)
Rat(304669) hook homolog 2 (Drosophila)
domestic guinea pig(100730349) hook homolog 2 (Drosophila)
naked mole-rat(101712752) hook homolog 2 (Drosophila)
sheep(101106005) hook homolog 2 (Drosophila)
Zebrafish(394086) hook homolog 2 (Drosophila)
dog(484928) hook homolog 2 (Drosophila)
Horse(100063380) hook homolog 2 (Drosophila)
cow(526516) hook homolog 2 (Drosophila)
domestic cat(101092830) hook homolog 2 (Drosophila)
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013312 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013312 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013312 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133255 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133255 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133255 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001100176 Rosetta Predictions human pricing
NM_013312 Rosetta Predictions human pricing
XM_001070888 Rosetta Predictions rat pricing
XM_239718 Rosetta Predictions rat pricing
NM_133255 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100176 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00321834 predicted 616
2 SASI_Hs02_00321835 predicted 2307
3 SASI_Hs02_00321836 predicted 1317
4 SASI_Hs02_00321837 predicted 1378
5 SASI_Hs02_00321838 predicted 277
6 SASI_Hs02_00321839 predicted 278
7 SASI_Hs02_00321840 predicted 569
8 SASI_Hs02_00321841 predicted 557
9 SASI_Hs02_00321842 predicted 2091
10 SASI_Hs02_00321843 predicted 1405
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013312 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00106002 predicted 619
2 SASI_Hs01_00106005 predicted 2312
3 SASI_Hs01_00106006 predicted 1318
4 SASI_Hs02_00344597 predicted 1378
5 SASI_Hs02_00344598 predicted 279
6 SASI_Hs02_00344599 predicted 279
7 SASI_Hs02_00344600 predicted 565
8 SASI_Hs01_00106007 predicted 555
9 SASI_Hs01_00106008 predicted 2096
10 SASI_Hs01_00106009 predicted 1403
11 SASI_Hs01_00106003 predicted 1749
12 SASI_Hs01_00106004 predicted 1990
13 SASI_Hs01_00106010 predicted 1747
14 SASI_Hs01_00106011 predicted 2058
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070888 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00333175 predicted 2071
2 SASI_Rn02_00333176 predicted 1761
3 SASI_Rn02_00333177 predicted 1241
4 SASI_Rn02_00333178 predicted 446
5 SASI_Rn02_00333179 predicted 789
6 SASI_Rn02_00333180 predicted 475
7 SASI_Rn02_00333181 predicted 329
8 SASI_Rn02_00333182 predicted 619
9 SASI_Rn02_00333183 predicted 471
10 SASI_Rn02_00333184 predicted 311
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_239718 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00391544 predicted 1092
2 SASI_Rn02_00391545 predicted 308
3 SASI_Rn02_00391546 predicted 649
4 SASI_Rn02_00391547 predicted 334
5 SASI_Rn02_00391548 predicted 1292
6 SASI_Rn02_00391549 predicted 472
7 SASI_Rn02_00391550 predicted 335
8 SASI_Rn02_00391551 predicted 699
9 SASI_Rn02_00391552 predicted 444
10 SASI_Rn02_00391553 predicted 1623
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133255 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00027253 predicted 615
2 SASI_Mm01_00027254 predicted 577
3 SASI_Mm02_00338515 predicted 2263
4 SASI_Mm01_00027255 predicted 468
5 SASI_Mm01_00027256 predicted 446
6 SASI_Mm01_00027257 predicted 2065
7 SASI_Mm01_00027258 predicted 1750
8 SASI_Mm01_00027259 predicted 792
9 SASI_Mm01_00027260 predicted 1235
10 SASI_Mm01_00027261 predicted 361
11 SASI_Mm01_00027262 predicted 516
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013312
HOOK2 MISSION shRNA Bacterial Glycerol Stock
hook microtubule-tethering protein 2
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000140075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013312.1-1232s1c1
Sequence:CCGGGCTATTTGAATGCCGCAACCTCTCGAGAGGTTGCGGCATTCAAATAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013312.1-486s1c1
Sequence:CCGGCTGGAAGAATCGGTTCAGCATCTCGAGATGCTGAACCGATTCTTCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013312.1-1716s1c1
Sequence:CCGGCAGAAGCTTCATGAGGCAGATCTCGAGATCTGCCTCATGAAGCTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013312.1-564s1c1
Sequence:CCGGCCAGAGACGTATGGCAACTTTCTCGAGAAAGTTGCCATACGTCTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013312.1-1820s1c1
Sequence:CCGGGCAGCATAACTTGCAGAAGAACTCGAGTTCTTCTGCAAGTTATGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013312.1-2006s1c1
Sequence:CCGGCCTGGAGATGGACTTTGAGAACTCGAGTTCTCAAAGTCCATCTCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013312.1-272s1c1
Sequence:CCGGGCTGAAGGTCAGCAATCTGAACTCGAGTTCAGATTGCTGACCTTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013312.1-498s1c1
Sequence:CCGGGTTCAGCATGTGGTGATGGAACTCGAGTTCCATCACCACATGCTGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013312.1-471s1c1
Sequence:CCGGCAGAGAATCATGACGCTGGAACTCGAGTTCCAGCGTCATGATTCTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013312.1-597s1c1
Sequence:CCGGCGCAGGTACTATTTCCTAAGTCTCGAGACTTAGGAAATAGTACCTGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013312.1-1660s1c1
Sequence:CCGGGCAAGACTGAAGATGCCATTTCTCGAGAAATGGCATCTTCAGTCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013312.1-1704s1c1
Sequence:CCGGGAGGAACATTTGCAGAAGCTTCTCGAGAAGCTTCTGCAAATGTTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013312.1-1664s1c1
Sequence:CCGGGACTGAAGATGCCATTTCCATCTCGAGATGGAAATGGCATCTTCAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013312
HOOK2 MISSION shRNA shRNA Plasmid DNA
hook microtubule-tethering protein 2
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000140075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013312.1-1232s1c1
Sequence:CCGGGCTATTTGAATGCCGCAACCTCTCGAGAGGTTGCGGCATTCAAATAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013312.1-486s1c1
Sequence:CCGGCTGGAAGAATCGGTTCAGCATCTCGAGATGCTGAACCGATTCTTCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013312.1-1716s1c1
Sequence:CCGGCAGAAGCTTCATGAGGCAGATCTCGAGATCTGCCTCATGAAGCTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013312.1-564s1c1
Sequence:CCGGCCAGAGACGTATGGCAACTTTCTCGAGAAAGTTGCCATACGTCTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013312.1-1820s1c1
Sequence:CCGGGCAGCATAACTTGCAGAAGAACTCGAGTTCTTCTGCAAGTTATGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013312.1-2006s1c1
Sequence:CCGGCCTGGAGATGGACTTTGAGAACTCGAGTTCTCAAAGTCCATCTCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013312.1-272s1c1
Sequence:CCGGGCTGAAGGTCAGCAATCTGAACTCGAGTTCAGATTGCTGACCTTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013312.1-498s1c1
Sequence:CCGGGTTCAGCATGTGGTGATGGAACTCGAGTTCCATCACCACATGCTGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013312.1-471s1c1
Sequence:CCGGCAGAGAATCATGACGCTGGAACTCGAGTTCCAGCGTCATGATTCTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013312.1-597s1c1
Sequence:CCGGCGCAGGTACTATTTCCTAAGTCTCGAGACTTAGGAAATAGTACCTGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013312.1-1660s1c1
Sequence:CCGGGCAAGACTGAAGATGCCATTTCTCGAGAAATGGCATCTTCAGTCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013312.1-1704s1c1
Sequence:CCGGGAGGAACATTTGCAGAAGCTTCTCGAGAAGCTTCTGCAAATGTTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013312.1-1664s1c1
Sequence:CCGGGACTGAAGATGCCATTTCCATCTCGAGATGGAAATGGCATCTTCAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013312
HOOK2 MISSION shRNA Lentiviral Transduction Particles
hook microtubule-tethering protein 2
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000140075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013312.1-1232s1c1
Sequence:CCGGGCTATTTGAATGCCGCAACCTCTCGAGAGGTTGCGGCATTCAAATAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013312.1-486s1c1
Sequence:CCGGCTGGAAGAATCGGTTCAGCATCTCGAGATGCTGAACCGATTCTTCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013312.1-1716s1c1
Sequence:CCGGCAGAAGCTTCATGAGGCAGATCTCGAGATCTGCCTCATGAAGCTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013312.1-564s1c1
Sequence:CCGGCCAGAGACGTATGGCAACTTTCTCGAGAAAGTTGCCATACGTCTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013312.1-1820s1c1
Sequence:CCGGGCAGCATAACTTGCAGAAGAACTCGAGTTCTTCTGCAAGTTATGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013312.1-2006s1c1
Sequence:CCGGCCTGGAGATGGACTTTGAGAACTCGAGTTCTCAAAGTCCATCTCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013312.1-272s1c1
Sequence:CCGGGCTGAAGGTCAGCAATCTGAACTCGAGTTCAGATTGCTGACCTTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013312.1-498s1c1
Sequence:CCGGGTTCAGCATGTGGTGATGGAACTCGAGTTCCATCACCACATGCTGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013312.1-471s1c1
Sequence:CCGGCAGAGAATCATGACGCTGGAACTCGAGTTCCAGCGTCATGATTCTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013312.1-597s1c1
Sequence:CCGGCGCAGGTACTATTTCCTAAGTCTCGAGACTTAGGAAATAGTACCTGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013312.1-1660s1c1
Sequence:CCGGGCAAGACTGAAGATGCCATTTCTCGAGAAATGGCATCTTCAGTCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013312.1-1704s1c1
Sequence:CCGGGAGGAACATTTGCAGAAGCTTCTCGAGAAGCTTCTGCAAATGTTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013312.1-1664s1c1
Sequence:CCGGGACTGAAGATGCCATTTCCATCTCGAGATGGAAATGGCATCTTCAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133255
VALIDATED
HOOK2 MISSION shRNA Bacterial Glycerol Stock
hook microtubule-tethering protein 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000111734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133255.1-2066s1c1
Sequence:CCGGGCTGCTTATCAGTGCCTGGTACTCGAGTACCAGGCACTGATAAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133255.1-449s1c1
Sequence:CCGGCTGTGCTATCAGTTGTGAGAACTCGAGTTCTCACAACTGATAGCACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133255.1-577s1c1
Sequence:CCGGCACCAGAGAATTACGGGAATTCTCGAGAATTCCCGTAATTCTCTGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133255.1-784s1c1
Sequence:CCGGGCCTCACAGCTAAGAAGCTATCTCGAGATAGCTTCTTAGCTGTGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111730    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133255.1-2335s1c1
Sequence:CCGGGCTTCCTTAGATGGGAGAGAACTCGAGTTCTCTCCCATCTAAGGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133255.1-449s21c1
Sequence:CCGGCTGTGCTATCAGTTGTGAGAACTCGAGTTCTCACAACTGATAGCACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133255.1-784s21c1
Sequence:CCGGGCCTCACAGCTAAGAAGCTATCTCGAGATAGCTTCTTAGCTGTGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133255.1-2066s21c1
Sequence:CCGGGCTGCTTATCAGTGCCTGGTACTCGAGTACCAGGCACTGATAAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133255.1-577s21c1
Sequence:CCGGCACCAGAGAATTACGGGAATTCTCGAGAATTCCCGTAATTCTCTGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316232    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133255.1-2335s21c1
Sequence:CCGGGCTTCCTTAGATGGGAGAGAACTCGAGTTCTCTCCCATCTAAGGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133255
VALIDATED
HOOK2 MISSION shRNA shRNA Plasmid DNA
hook microtubule-tethering protein 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000111734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133255.1-2066s1c1
Sequence:CCGGGCTGCTTATCAGTGCCTGGTACTCGAGTACCAGGCACTGATAAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133255.1-449s1c1
Sequence:CCGGCTGTGCTATCAGTTGTGAGAACTCGAGTTCTCACAACTGATAGCACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133255.1-577s1c1
Sequence:CCGGCACCAGAGAATTACGGGAATTCTCGAGAATTCCCGTAATTCTCTGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133255.1-784s1c1
Sequence:CCGGGCCTCACAGCTAAGAAGCTATCTCGAGATAGCTTCTTAGCTGTGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111730    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133255.1-2335s1c1
Sequence:CCGGGCTTCCTTAGATGGGAGAGAACTCGAGTTCTCTCCCATCTAAGGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133255.1-449s21c1
Sequence:CCGGCTGTGCTATCAGTTGTGAGAACTCGAGTTCTCACAACTGATAGCACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133255.1-784s21c1
Sequence:CCGGGCCTCACAGCTAAGAAGCTATCTCGAGATAGCTTCTTAGCTGTGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133255.1-2066s21c1
Sequence:CCGGGCTGCTTATCAGTGCCTGGTACTCGAGTACCAGGCACTGATAAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133255.1-577s21c1
Sequence:CCGGCACCAGAGAATTACGGGAATTCTCGAGAATTCCCGTAATTCTCTGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316232    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133255.1-2335s21c1
Sequence:CCGGGCTTCCTTAGATGGGAGAGAACTCGAGTTCTCTCCCATCTAAGGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133255
VALIDATED
HOOK2 MISSION shRNA Lentiviral Transduction Particles
hook microtubule-tethering protein 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000111734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133255.1-2066s1c1
Sequence:CCGGGCTGCTTATCAGTGCCTGGTACTCGAGTACCAGGCACTGATAAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133255.1-449s1c1
Sequence:CCGGCTGTGCTATCAGTTGTGAGAACTCGAGTTCTCACAACTGATAGCACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133255.1-577s1c1
Sequence:CCGGCACCAGAGAATTACGGGAATTCTCGAGAATTCCCGTAATTCTCTGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133255.1-784s1c1
Sequence:CCGGGCCTCACAGCTAAGAAGCTATCTCGAGATAGCTTCTTAGCTGTGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111730    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133255.1-2335s1c1
Sequence:CCGGGCTTCCTTAGATGGGAGAGAACTCGAGTTCTCTCCCATCTAAGGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133255.1-449s21c1
Sequence:CCGGCTGTGCTATCAGTTGTGAGAACTCGAGTTCTCACAACTGATAGCACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133255.1-784s21c1
Sequence:CCGGGCCTCACAGCTAAGAAGCTATCTCGAGATAGCTTCTTAGCTGTGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133255.1-2066s21c1
Sequence:CCGGGCTGCTTATCAGTGCCTGGTACTCGAGTACCAGGCACTGATAAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133255.1-577s21c1
Sequence:CCGGCACCAGAGAATTACGGGAATTCTCGAGAATTCCCGTAATTCTCTGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316232    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133255.1-2335s21c1
Sequence:CCGGGCTTCCTTAGATGGGAGAGAACTCGAGTTCTCTCCCATCTAAGGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)