EMAIL THIS PAGE TO A FRIEND

HOOK3

hook microtubule-tethering protein 3

170 Gene Product Result for
Synonyms: HK3
UniProtKB ID: Q86VS8, D3DSY8, Q8NBH0, Q9BY13
Gene ID:
Human(84376) Summary: Hook proteins are cytosolic coiled-coil proteins that contain conserved N-terminal domains, which attach to microtubules, and more divergent C-terminal domains, which mediate binding to organelles. The Drosophila Hook protein is a component of the endocytic compartment.[supplied by OMIM, Apr 2004]
Mouse(320191) hook homolog 3 (Drosophila)
Rat(306548) hook homolog 3 (Drosophila)
Zebrafish(100037261) hook homolog 3 (Drosophila)
cow(524648) hook homolog 3 (Drosophila)
Horse(100053799) hook homolog 3 (Drosophila)
domestic cat(101101306) hook homolog 3 (Drosophila)
dog(475567) hook homolog 3 (Drosophila)
chicken(427297) hook homolog 3 (Drosophila)
Goat(100861101) hook homolog 3 (Drosophila)
Domestic Rabbit(100347440) hook homolog 3 (Drosophila)
sheep(101123347) hook homolog 3 (Drosophila)
domestic guinea pig(100718881) hook homolog 3 (Drosophila)
naked mole-rat(101704484) hook homolog 3 (Drosophila)
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_134108 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_134108 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_134108 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032410 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032410 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032410 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032410 Rosetta Predictions human pricing
XM_001062163 Rosetta Predictions rat pricing
XM_224952 Rosetta Predictions rat pricing
NM_207659 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032410 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00151789 predicted 1502
2 SASI_Hs01_00151790 predicted 1278
3 SASI_Hs01_00151791 predicted 1925
4 SASI_Hs01_00151792 predicted 2031
5 SASI_Hs01_00151794 predicted 638
6 SASI_Hs01_00151795 predicted 1787
7 SASI_Hs01_00151796 predicted 1550
8 SASI_Hs01_00151797 predicted 582
9 SASI_Hs01_00151798 predicted 1217
10 SASI_Hs02_00359805 predicted 434
11 SASI_Hs01_00151793 predicted 1852
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001062163 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00302561 predicted 876
2 SASI_Rn02_00302562 predicted 2295
3 SASI_Rn02_00302563 predicted 1987
4 SASI_Rn02_00302564 predicted 662
5 SASI_Rn02_00302565 predicted 1806
6 SASI_Rn02_00302566 predicted 1512
7 SASI_Rn02_00302567 predicted 2377
8 SASI_Rn02_00302568 predicted 2031
9 SASI_Rn02_00302569 predicted 2266
10 SASI_Rn02_00302570 predicted 989
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_224952 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00382387 predicted 1816
2 SASI_Rn02_00382388 predicted 1901
3 SASI_Rn02_00382389 predicted 1837
4 SASI_Rn02_00382390 predicted 1846
5 SASI_Rn02_00382391 predicted 1823
6 SASI_Rn02_00382392 predicted 1928
7 SASI_Rn02_00382393 predicted 1934
8 SASI_Rn02_00382394 predicted 1867
9 SASI_Rn02_00382395 predicted 1842
10 SASI_Rn02_00382396 predicted 1924
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207659 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00187318 predicted 885
2 SASI_Mm01_00187319 predicted 1439
3 SASI_Mm01_00187320 predicted 674
4 SASI_Mm02_00352177 predicted 2428
5 SASI_Mm01_00187322 predicted 709
6 SASI_Mm01_00187324 predicted 1517
7 SASI_Mm02_00352178 predicted 369
8 SASI_Mm02_00352179 predicted 2280
9 SASI_Mm01_00187325 predicted 410
10 SASI_Mm02_00352180 predicted 404
11 SASI_Mm01_00187321 predicted 1535
12 SASI_Mm01_00187323 predicted 1616
13 SASI_Mm01_00187326 predicted 1713
14 SASI_Mm01_00187327 predicted 401
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_134108
VALIDATED
HOOK3 MISSION shRNA Bacterial Glycerol Stock
hook microtubule-tethering protein 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000111670    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_134108.3-3398s1c1
Sequence:CCGGGCTTACATTATATGCCACATTCTCGAGAATGTGGCATATAATGTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_134108.3-1571s1c1
Sequence:CCGGCAGAGATTGTTACACCCGAAACTCGAGTTTCGGGTGTAACAATCTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_134108.3-352s1c1
Sequence:CCGGCCTGTATATTTCGACGATAATCTCGAGATTATCGTCGAAATATACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_134108.3-1876s1c1
Sequence:CCGGGCCAACAATGAATTGCAGAAACTCGAGTTTCTGCAATTCATTGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_134108.3-2037s1c1
Sequence:CCGGCAAGAGTGTTATCCGTACATTCTCGAGAATGTACGGATAACACTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_134108
VALIDATED
HOOK3 MISSION shRNA shRNA Plasmid DNA
hook microtubule-tethering protein 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000111670    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_134108.3-3398s1c1
Sequence:CCGGGCTTACATTATATGCCACATTCTCGAGAATGTGGCATATAATGTAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_134108.3-1571s1c1
Sequence:CCGGCAGAGATTGTTACACCCGAAACTCGAGTTTCGGGTGTAACAATCTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_134108.3-352s1c1
Sequence:CCGGCCTGTATATTTCGACGATAATCTCGAGATTATCGTCGAAATATACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_134108.3-1876s1c1
Sequence:CCGGGCCAACAATGAATTGCAGAAACTCGAGTTTCTGCAATTCATTGTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_134108.3-2037s1c1
Sequence:CCGGCAAGAGTGTTATCCGTACATTCTCGAGAATGTACGGATAACACTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_134108
VALIDATED
HOOK3 MISSION shRNA Lentiviral Transduction Particles
hook microtubule-tethering protein 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000111670    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_134108.3-3398s1c1
Sequence:CCGGGCTTACATTATATGCCACATTCTCGAGAATGTGGCATATAATGTAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_134108.3-1571s1c1
Sequence:CCGGCAGAGATTGTTACACCCGAAACTCGAGTTTCGGGTGTAACAATCTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_134108.3-352s1c1
Sequence:CCGGCCTGTATATTTCGACGATAATCTCGAGATTATCGTCGAAATATACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_134108.3-1876s1c1
Sequence:CCGGGCCAACAATGAATTGCAGAAACTCGAGTTTCTGCAATTCATTGTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_134108.3-2037s1c1
Sequence:CCGGCAAGAGTGTTATCCGTACATTCTCGAGAATGTACGGATAACACTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032410
VALIDATED
HOOK3 MISSION shRNA Bacterial Glycerol Stock
hook microtubule-tethering protein 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149507    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032410.2-2121s1c1
Sequence:CCGGGCACCAGAAATACAAGCTCTTCTCGAGAAGAGCTTGTATTTCTGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032410.2-654s1c1
Sequence:CCGGGCCATTATGATGATGGAGGAACTCGAGTTCCTCCATCATCATAATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032410.2-1854s1c1
Sequence:CCGGGCAGAAGATTCAGTCCTTCTACTCGAGTAGAAGGACTGAATCTTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032410.2-1157s1c1
Sequence:CCGGGCTGAGACATTCTTCTGATAACTCGAGTTATCAGAAGAATGTCTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435521    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032410.3-2470s21c1
Sequence:CCGGGGAAACTCAGCCAGCTTATTTCTCGAGAAATAAGCTGGCTGAGTTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032410.3-892s21c1
Sequence:CCGGTGGCAGAGAATCAGGTATTAACTCGAGTTAATACCTGATTCTCTGCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032410.3-2085s21c1
Sequence:CCGGATCCGTACTTTAGATCCTAAACTCGAGTTTAGGATCTAAAGTACGGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032410.3-1551s21c1
Sequence:CCGGCTCACAACACAAGGGTTAATGCTCGAGCATTAACCCTTGTGTTGTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032410
VALIDATED
HOOK3 MISSION shRNA shRNA Plasmid DNA
hook microtubule-tethering protein 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149507    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032410.2-2121s1c1
Sequence:CCGGGCACCAGAAATACAAGCTCTTCTCGAGAAGAGCTTGTATTTCTGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032410.2-654s1c1
Sequence:CCGGGCCATTATGATGATGGAGGAACTCGAGTTCCTCCATCATCATAATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032410.2-1854s1c1
Sequence:CCGGGCAGAAGATTCAGTCCTTCTACTCGAGTAGAAGGACTGAATCTTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032410.2-1157s1c1
Sequence:CCGGGCTGAGACATTCTTCTGATAACTCGAGTTATCAGAAGAATGTCTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435521    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032410.3-2470s21c1
Sequence:CCGGGGAAACTCAGCCAGCTTATTTCTCGAGAAATAAGCTGGCTGAGTTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032410.3-892s21c1
Sequence:CCGGTGGCAGAGAATCAGGTATTAACTCGAGTTAATACCTGATTCTCTGCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032410.3-2085s21c1
Sequence:CCGGATCCGTACTTTAGATCCTAAACTCGAGTTTAGGATCTAAAGTACGGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032410.3-1551s21c1
Sequence:CCGGCTCACAACACAAGGGTTAATGCTCGAGCATTAACCCTTGTGTTGTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032410
VALIDATED
HOOK3 MISSION shRNA Lentiviral Transduction Particles
hook microtubule-tethering protein 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149507    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032410.2-2121s1c1
Sequence:CCGGGCACCAGAAATACAAGCTCTTCTCGAGAAGAGCTTGTATTTCTGGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032410.2-654s1c1
Sequence:CCGGGCCATTATGATGATGGAGGAACTCGAGTTCCTCCATCATCATAATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032410.2-1854s1c1
Sequence:CCGGGCAGAAGATTCAGTCCTTCTACTCGAGTAGAAGGACTGAATCTTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032410.2-1157s1c1
Sequence:CCGGGCTGAGACATTCTTCTGATAACTCGAGTTATCAGAAGAATGTCTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435521    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032410.3-2470s21c1
Sequence:CCGGGGAAACTCAGCCAGCTTATTTCTCGAGAAATAAGCTGGCTGAGTTTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032410.3-892s21c1
Sequence:CCGGTGGCAGAGAATCAGGTATTAACTCGAGTTAATACCTGATTCTCTGCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032410.3-2085s21c1
Sequence:CCGGATCCGTACTTTAGATCCTAAACTCGAGTTTAGGATCTAAAGTACGGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032410.3-1551s21c1
Sequence:CCGGCTCACAACACAAGGGTTAATGCTCGAGCATTAACCCTTGTGTTGTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)